Soil samples
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA588708 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Illumina MiSeq high-throughput sequencing Raw sequence reads
| PRJNA588632 | ENA
Project description:Illumina MiSeq high-throughput sequencing for six opencast coal mine sites Raw sequence reads
| PRJNA533184 | ENA
Project description:fungal community using Miseq Raw sequence reads
| PRJNA393293 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Methods: The cDNA libraries from 3 pooled samples of liver tissues for each group were sequenced to generate RNA profiles using Illumina Miseq platform Results: The sequencing runs yielded a total of 22.67 M reads with an average length of 100 bp. The high-throughput sequencing performed for liver samples with different treatments showed similar numbers of yielded reads ranged from 5.57 to 5.74 M and the same average length. The Strand NGS software (version 2.1) was used using default parameters for pre-alignment and post-alignment quality control analysis and 100% of the raw reads remained in the dataset. Of these, 19.02 M reads (84%) were mapped into contigs of the rat genome (rn5) and identified 31457 transcripts in liver samples.
2015-10-01 | GSE69783 | GEO
Project description:Methods: The cDNA libraries from 3 pooled samples of cultured cells for each group were sequenced to generate RNA profiles using Illumina Miseq platform Results: The sequencing runs yielded a total of 95.01 M reads with an average length of 73-74 bp. The high-throughput sequencing performed for liver samples with different treatments showed similar numbers of yielded reads ranged from 5.57 to 5.74 M and the same average length. The Strand NGS software (version 2.1) was used using default parameters for pre-alignment and post-alignment quality control analysis and 100% of the raw reads remained in the dataset. Of these, 19.02 M reads (84%) were mapped into contigs of the rat genome (rn5) and identified 31457 transcripts in liver samples.
2017-01-31 | GSE86344 | GEO
Project description:Raw sequence reads for fungal community as affected by different forest management types
| PRJNA1112306 | ENA
Project description:Aureobasidium pullulans is being studied with respect to its biotechnological applications in the degradation and modification of lignocellulose substrates or the production of the polysaccharide pullulan. In addition, the species is also used as a commercial plant protection agent against the bacterial pome fruit disease fireblight or against fungal postharvest diseases of fruits. The A. pullulans strain NBB 7.2.1 was originally isolated from a soil sample (from a Swiss orchard), but it was shown to be more competitive on apples than in soil (Gross et al., 2018). The antifungal activity of the isolate NBB 7.2.1 against fungal plant pathogens, and filamentous fungi in general, was assessed: Among 40 different yeasts, it belonged to the most strongly antifungal isolates (Hilber-Bodmer et al., 2017). The genome of A. pullulans NBB 7.2.1 was sequenced and de novo assembled by Agroscope using a combination of long reads from Pacific Biosciences Sequel technology and Illumina MiSeq short read data and subsequently annotated by JGI. The high quality genome sequence (comprising 12 chromosomes and one circular mitogenome) serves as the foundation for identifying the underlying molecular mechanisms that confer antifungal activity and to determine which factors may be targeted to improve the reliability and efficacy of A. pullulans as a plant protection agent in the field and under storage conditions.
This dataset contains raw reads for four replicates of three fungal culture supernatants
B1 Files: A_pul_F_ox: Interaction of A. pullulans and F. oxysporum in peptone buffer
B2 Files: Aureobasidium: Pure culture of A. pullulans in peptone buffer
B3 Files: Fusarium: Pure culture of F. oxysporum in peptone buffer
2021-03-03 | MSV000086991 | MassIVE