Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:Methods: The cDNA libraries from 3 pooled samples of liver tissues for each group were sequenced to generate RNA profiles using Illumina Miseq platform Results: The sequencing runs yielded a total of 22.67 M reads with an average length of 100 bp. The high-throughput sequencing performed for liver samples with different treatments showed similar numbers of yielded reads ranged from 5.57 to 5.74 M and the same average length. The Strand NGS software (version 2.1) was used using default parameters for pre-alignment and post-alignment quality control analysis and 100% of the raw reads remained in the dataset. Of these, 19.02 M reads (84%) were mapped into contigs of the rat genome (rn5) and identified 31457 transcripts in liver samples.
Project description:Methods: The cDNA libraries from 3 pooled samples of cultured cells for each group were sequenced to generate RNA profiles using Illumina Miseq platform Results: The sequencing runs yielded a total of 95.01 M reads with an average length of 73-74 bp. The high-throughput sequencing performed for liver samples with different treatments showed similar numbers of yielded reads ranged from 5.57 to 5.74 M and the same average length. The Strand NGS software (version 2.1) was used using default parameters for pre-alignment and post-alignment quality control analysis and 100% of the raw reads remained in the dataset. Of these, 19.02 M reads (84%) were mapped into contigs of the rat genome (rn5) and identified 31457 transcripts in liver samples.
