Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:Methods: The cDNA libraries from 3 pooled samples of liver tissues for each group were sequenced to generate RNA profiles using Illumina Miseq platform Results: The sequencing runs yielded a total of 22.67 M reads with an average length of 100 bp. The high-throughput sequencing performed for liver samples with different treatments showed similar numbers of yielded reads ranged from 5.57 to 5.74 M and the same average length. The Strand NGS software (version 2.1) was used using default parameters for pre-alignment and post-alignment quality control analysis and 100% of the raw reads remained in the dataset. Of these, 19.02 M reads (84%) were mapped into contigs of the rat genome (rn5) and identified 31457 transcripts in liver samples.
Project description:Methods: The cDNA libraries from 3 pooled samples of cultured cells for each group were sequenced to generate RNA profiles using Illumina Miseq platform Results: The sequencing runs yielded a total of 95.01 M reads with an average length of 73-74 bp. The high-throughput sequencing performed for liver samples with different treatments showed similar numbers of yielded reads ranged from 5.57 to 5.74 M and the same average length. The Strand NGS software (version 2.1) was used using default parameters for pre-alignment and post-alignment quality control analysis and 100% of the raw reads remained in the dataset. Of these, 19.02 M reads (84%) were mapped into contigs of the rat genome (rn5) and identified 31457 transcripts in liver samples.
2017-01-31 | GSE86344 | GEO
Project description:Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms (MiSeq)
| PRJEB18924 | ENA
Project description:Illumina MiSeq sequencing of fungal mock community
Project description:In this project, in vitro selection was carried out to generate DNAzymes for Eosinophil peroxidase using a synthetic DNA library. Total 15 rounds of selections were carried out. The DNA molecules obtain in round 15, was applied in Illumina MiSeq deep sequencing which provided fastq files. Sequencing samples were prepared from each parallel SELEX experiment by PCR tagging with Illumina sequencing primers. Samples were size purified by agarose gel electrophoresis prior to being quantified by measuring absorbance at 260 nm. Tagged samples were pooled and paired-end sequenced on an Illumina MiSeq high-throughput DNA sequencer. Sequence data processing was performed on a Windows 10 computer running Ubuntu 20.04 under WSL2. Raw paired-end reads were trimmed of sequencing and library primers using cutadapt 3.4. Trimmed paired-end reads were then: 1) merged into a consensus sense read; 2) dereplicated; and, 3) clustered at 90% identity using USEARCH v11.0.667_i86linux32. Sequence frequencies and ranking lists were generated using custom Python scripts. Multiple sequence alignments were performed using MUSCLE v3.8.1551 and converted to sequence logos using WebLogo 3.7.8. Processed sequencing data and cluster linkage data were stored on a MySQL 8.0.22 database. Analysis of sequence copy number, frequency, cluster linkage and data plots were performed using the database and Microsoft Excel Top 20 sequences were tested for cleavage performance. The most active DNAzyme was characterized and optimized. At the end, fluorescence and lateral flow assays were developed and evaluated in real patients' sputums.
