Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Primate cell fusion disentangles gene regulatory divergence in neural development

ABSTRACT: Primate cell fusion disentangles gene regulatory divergence in neural development

PROVIDER: PRJNA605139 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR11034000_1.fastq.gz	Fastqsanger.gz
	SRR11034000_2.fastq.gz	Fastqsanger.gz
	SRR11034100_1.fastq.gz	Fastqsanger.gz
	SRR11034100_2.fastq.gz	Fastqsanger.gz
	SRR11034200_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 1776

Similar Datasets

Primate cell fusion disentangles gene regulatory divergence in neural development

Project description:Among primates, humans display a unique trajectory of development responsible for the many traits specific to our species. However, the inaccessibility of human and chimpanzee primary tissues has limited our ability to study human evolution. Comparative in vitro approaches using primate-derived induced pluripotent stem cells have begun to reveal species differences on the cellular and molecular levels. In particular, brain organoids have emerged as a promising platform to study primate neural development in vitro, although cross-species comparisons of organoids are complicated by differences in developmental timing and variability of differentiation. Here, we developed a new platform to address these limitations. We first generated a panel of tetraploid hybrid stem cells by fusing human and chimpanzee induced pluripotent stem cells. We next applied this approach to study species divergence in cerebral cortical development by differentiating them into neural organoids. We found that hybrid organoids provide a controlled system for disentangling cis- and trans-acting gene expression divergence across cell types and developmental stages, revealing a signature of selection on astrocyte-related genes. In addition, we identified an up-regulation of human somatostatin receptor 2 (SSTR2), which regulates neuronal calcium signaling and is associated with neuropsychiatric disorders. We discovered a human-specific response to modulation of SSTR2 function in cortical neurons, underscoring the potential of this unique platform to reveal the molecular basis of human evolution.

2020-11-17 | GSE144825 | GEO

Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest

2015-09-11 | GSE70751 | GEO

Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest

Project description:Here we derive human and chimpanzee cranial neural crest cells (CNCCs) and profile histone modifications, transcription factors, chromatin accessibility and gene expression to systematically and quantitatively annotate evolutionary divergence of craniofacial cis-regulatory landscapes. Histone modifications (H3K27ac, H3K4me1, H3K4me3, H3K27me3), chromatin modifiers (p300), transcription factors (NR2F1, TFAP2A), chromatin accessibility (ATACseq) and gene expression (RNAseq) were assayed in CNCCs derived from iPSCs/ESCs from 2 chimpanzee and 3 human individuals.

2015-09-11 | E-GEOD-70751 | biostudies-arrayexpress

Heliconius neural divergence

Project description:Neural divergence and hybrid disruption between ecologically isolated Heliconius butterflies

| PRJEB42387 | ENA

Regulatory divergence during limb evolution

Project description:Regulatory divergence during limb evolution

| PRJNA521485 | ENA

Primate cell fusion disentangles gene regulatory divergence in neurodevelopment.

Project description:Among primates, humans display a unique trajectory of development that is responsible for the many traits specific to our species. However, the inaccessibility of primary human and chimpanzee tissues has limited our ability to study human evolution. Comparative in vitro approaches using primate-derived induced pluripotent stem cells have begun to reveal species differences on the cellular and molecular levels1,2. In particular, brain organoids have emerged as a promising platform to study primate neural development in vitro3-5, although cross-species comparisons of organoids are complicated by differences in developmental timing and variability of differentiation6,7. Here we develop a new platform to address these limitations by fusing human and chimpanzee induced pluripotent stem cells to generate a panel of tetraploid hybrid stem cells. We applied this approach to study species divergence in cerebral cortical development by differentiating these cells into neural organoids. We found that hybrid organoids provide a controlled system for disentangling cis- and trans-acting gene-expression divergence across cell types and developmental stages, revealing a signature of selection on astrocyte-related genes. In addition, we identified an upregulation of the human somatostatin receptor 2 gene (SSTR2), which regulates neuronal calcium signalling and is associated with neuropsychiatric disorders8,9. We reveal a human-specific response to modulation of SSTR2 function in cortical neurons, underscoring the potential of this platform for elucidating the molecular basis of human evolution.

| S-EPMC8719633 | biostudies-literature

Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest

Project description:Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest

| PRJNA289483 | ENA

Regulatory divergence during pig limb evolution

Project description:Regulatory divergence during pig limb evolution

| PRJNA521488 | ENA

Regulatory divergence during mouse limb evolution

Project description:Regulatory divergence during mouse limb evolution

| PRJNA521487 | ENA

Human-chimpanzee hybrid cells reveal gene regulatory evolution underlying skeletal divergence

Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).

2020-10-09 | GSE146481 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data