Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Microbial community structure between water and sediment in artificial reefs detected by primer V3-V4

PROVIDER: PRJNA687880 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR13307800_1.fastq.gz	Fastqsanger.gz
	SRR13307800_2.fastq.gz	Fastqsanger.gz
	SRR13307777_1.fastq.gz	Fastqsanger.gz
	SRR13307777_2.fastq.gz	Fastqsanger.gz
	SRR13307778_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 48

Similar Datasets

Project description:Microbial community structure between water and sediment in artificial reefs detected by primer V4

| PRJNA687879 | ENA

Microbial community structure of a lotic aquatic system receiving wastewater effluent

2016-01-01 | GSE73842 | GEO

Microbial community structure of a lotic aquatic system receiving wastewater effluent

Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles. A total of 56 samples were collected that represent water and sediment samples from 14 sample sites over two different time points (November 18 and 25, 2011).

2016-07-03 | E-GEOD-73842 | biostudies-arrayexpress

Evaluation of primers targeting V1-V2 versus V3-V4 region of 16S rRNA for oral microbiome study

Project description:Primer output comparison targeting V1-V2 vs V3-V4

| PRJEB63675 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Danube_16S

Project description:16S V3-V4 metagenome from four Danube water samples

| PRJEB11278 | ENA

Project description:Bacterial V3-V4 region isolated from fresh water sponge

| PRJNA1069358 | ENA

BZO_16S

Project description:BZO_16S V3-V4 Metagenome

| PRJNA839896 | ENA

CWO_16S

Project description:CWO_16S V3-V4 Metagenome

| PRJNA839897 | ENA