Coagulation Factor XIII-Binding Aptamers as Bivalent Ligands Targeting Fibrin and Activated Platelets in the Thrombus
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA688234 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Thromboembolic diseases are commonly associated with thrombus-induced ischemia and tissue damage; identification of the location of the thrombus, or thrombus-targeting, may facilitate diagnosis and target therapy. We hypothesized that aptamers with high affinity and specificity for coagulation factor XIII (FXIII) can serve as thrombus-targeting probes. With systematic evolution of ligands by exponential enrichment technology and semi-activated FXIII (FXIII’) as the target, guanine-rich FXIII’-binding aptamers (FAs; 76 nt) were selected from a library of single-stranded DNA. Next generation sequencing identified FAs with the highest frequency; bio-layer interferometry revealed a dissociation constant (Kd) from 0.7 to 2.5 nM. Truncation with preservation of a conserved region based on entropy analysis resulted in three truncated FAs (FATs; 41-47 nt) that exhibited 4-fold signal in binding to activated vs. resting platelets, as determined by flowcytometry. In addition, FAT2 exhibited up to 4.2-fold binding of that from scrambled ssDNA to platelet/fibrin clot or whole blood clot in vitro, suggesting binding to both activated plateltes and fibrin. FAT2 also exhibited targeting effects in a microcirculatory thrombosis model in mice. Nevertheless, FATs induced no effect on blood coagulation, as determined by thromboelastometry. In conclusion, FXIII-binding aptamers are potentially amenable to thrombus targeting in theranostic application of thromboembolic diseases.
2023-12-28 | GSE163934 | GEO
Project description:Activation of innate immunity and deposition of blood-derived fibrin in the central nervous system (CNS) occur in autoimmune and neurodegenerative diseases, including multiple sclerosis (MS) and Alzheimer’s disease (AD). However, mechanisms linking blood-brain barrier (BBB) disruption with neurodegeneration are poorly understood, and exploration of fibrin as a therapeutic target has been limited by its beneficial clotting functions. Here we report the generation of monoclonal antibody 5B8 targeted against the cryptic fibrin epitope γ377-395 to selectively inhibit fibrin-induced inflammation. 5B8 suppressed fibrin-induced proinflammatory gene expression, nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activation, and oxidative stress. In animal models of MS and AD, 5B8 entered the CNS and bound to parenchymal fibrin, and its therapeutic administration reduced innate immune activation and neurodegeneration without interfering with clotting. Thus, fibrin-targeting immunotherapy inhibits autoimmune- and amyloid-driven neurotoxicity and may have clinical benefit without globally suppressing innate immunity or interfering with coagulation in diverse neurological diseases.
2019-02-13 | GSE118921 | GEO
Project description:Hyperlipidemia is a well-established risk factor for cardiovascular diseases. Trillions of people worldwide display mildly elevated levels of plasma lipids and cholesterol due to diet and life-style. The relationship between severe hyperlipidemia and thrombosis has been extensively investigated, but the effects of the preliminary stages of hyperlipidemia on platelet function are unclear. Therefore, we investigated how moderate elevation of different plasma lipid profiles influence platelet activation and thrombus formation, as compared to higher plasma lipid concentrations. Hyperlipidemic Apoe-/- and Ldlr-/- and wild-type mice were fed a normal chow diet, resulting in mildly increased plasma cholesterol. Blood from both knockout mice was used in comparison to wild-type mice, for multiparameter ex vivo measurements of thrombus formation under flow. Whole blood (fibrin-)thrombus formation on collagen in the absence or presence of coagulation (with(out) tissue factor), indicated enhancement of the thrombotic process in both knockout mice. These effects were not further aggravated in aged mice, as well as in Apoe-/- mice on high fat diet with very high plasma cholesterol levels. Bone marrow chimeras of wild-type or Ldlr-/- platelets into irradiated Ldlr-/- recipient mice showed similar thrombus formation patterns. This suggested that hyperlipidemia itself, not the platelet LDL receptor deficiency is responsible for the altered platelet activation status in Ldlr-/- mice. Exploration of the platelet proteome revealed high similarity between the three genotypes, although some proteins showed significantly changed expression in Apoe-/- mice. Finally, platelet lipidomic analysis showed an increased lipid profile in mildly hyperlipidemic mice, which may further contribute to the observed prothrombotic phenotype
2021-01-08 | PXD020276 | Pride
Project description:Collagen- and fibrin-based gels are extensively used to study cell behaviour. However, 2D-3D, collagen-fibrin, and in vivo-in vitro comparisons of gene expression, cell shape and mechanotransduction have not been reported. Here we compared chick tendon fibroblasts (CTFs) at three stages of embryonic development with CTFs cultured in collagen- or fibrin-based tissue engineered constructs (TECs).
2015-09-30 | E-MTAB-3488 | biostudies-arrayexpress
Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.
2022-02-28 | PXD002480 | Pride
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:Mathematical model of the blood coagulation cascade. Extended Hockin model with contributions from Kim2007, Naski1991, Schneider2004, Horrevoets1996, Brummel-Ziedins2012, Mitrophanov2012, Danforth2009 and Hekman1988. Model incorporates more fibrin associated species such as fibrin I and II monomers and fibrinopeptide A and B as well as factor V fragments.
2018-06-26 | MODEL1806260001 | BioModels
Project description:Life-threatening thrombotic events and neurological symptoms are prevalent in COVID-19 and are persistent in patients with long COVID experiencing post-acute sequelae of SARS-CoV-2 infection1,2,3,4. Despite the clinical evidence1,5,6,7, the underlying mechanisms of coagulopathy in COVID-19 and its consequences in inflammation and neuropathology remain poorly understood and treatment options are insufficient. Fibrinogen, the central structural component of blood clots, is abundantly deposited in the lungs and brains of patients with COVID-19, correlates with disease severity and is a predictive biomarker for post-COVID-19 cognitive deficits1,5,8,9,10. Here we show that fibrin binds to the SARS-CoV-2 spike protein, forming proinflammatory blood clots that drive systemic thromboinflammation and neuropathology in COVID-19. Fibrin, acting through its inflammatory domain, is required for oxidative stress and macrophage activation in the lungs, whereas it suppresses natural killer cells, after SARS-CoV-2 infection. Fibrin promotes neuroinflammation and neuronal loss after infection, as well as innate immune activation in the brain and lungs independently of active infection. A monoclonal antibody targeting the inflammatory fibrin domain provides protection from microglial activation and neuronal injury, as well as from thromboinflammation in the lung after infection. Thus, fibrin drives inflammation and neuropathology in SARS-CoV-2 infection, and fibrin-targeting immunotherapy may represent a therapeutic intervention for patients with acute COVID-19 and long COVID.
2024-06-28 | GSE268812 | GEO
Project description:Life-threatening thrombotic events and neurological symptoms are prevalent in COVID-19 and are persistent in patients with long COVID experiencing post-acute sequelae of SARS-CoV-2 infection1,2,3,4. Despite the clinical evidence1,5,6,7, the underlying mechanisms of coagulopathy in COVID-19 and its consequences in inflammation and neuropathology remain poorly understood and treatment options are insufficient. Fibrinogen, the central structural component of blood clots, is abundantly deposited in the lungs and brains of patients with COVID-19, correlates with disease severity and is a predictive biomarker for post-COVID-19 cognitive deficits1,5,8,9,10. Here we show that fibrin binds to the SARS-CoV-2 spike protein, forming proinflammatory blood clots that drive systemic thromboinflammation and neuropathology in COVID-19. Fibrin, acting through its inflammatory domain, is required for oxidative stress and macrophage activation in the lungs, whereas it suppresses natural killer cells, after SARS-CoV-2 infection. Fibrin promotes neuroinflammation and neuronal loss after infection, as well as innate immune activation in the brain and lungs independently of active infection. A monoclonal antibody targeting the inflammatory fibrin domain provides protection from microglial activation and neuronal injury, as well as from thromboinflammation in the lung after infection. Thus, fibrin drives inflammation and neuropathology in SARS-CoV-2 infection, and fibrin-targeting immunotherapy may represent a therapeutic intervention for patients with acute COVID-19 and long COVID.
2024-06-28 | GSE268810 | GEO
Project description:There is an urgent need for agents that promote health and regeneration of cells and tissues, specifically to treat diseases of the aging nervous system. Age-associated nervous system degeneration and various diseases are driven by many different biochemical stresses, often making it difficult to target any one disease cause. Our laboratory has previously identified DNA aptamers with apparent regenerative properties in murine models of multiple sclerosis by selecting aptamers that bind oligodendrocyte membrane preparations. Here, we selected from vast libraries of molecules (~1014 unique DNAs) those with the ability to bind cultured human SH-SY5Y neuroblastoma cells as a neuronal model, followed by screening for aptamers capable of eliciting biological responses, with validation of binding in differentiated SH-SY5Y, human iPSC-derived sensory neurons, and hESC derived cortical neurons. This demonstrates a proof-of-concept workflow to identify biologically active aptamers by cycles of cell selection.
2024-11-11 | GSE278187 | GEO