Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rNRA amplicon sequences of semi-arid Xinglong Mountain, Northwest China

PROVIDER: PRJNA713510 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR13944409.fastq.gz	Fastqsanger.gz
	SRR13944410.fastq.gz	Fastqsanger.gz
	SRR13944411.fastq.gz	Fastqsanger.gz
	SRR13943165.fastq.gz	Fastqsanger.gz
	SRR13943166.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 9

Similar Datasets

Global transcriptome analysis of gene expression changes in Mesorhizobium alhagi CCNWXJ12-2 under salt stress

2014-05-06 | GSE57306 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:nosZ clade II sequences from semi-arid cotton cropping systems

| PRJNA612879 | ENA

Project description:Bacterial community structure in a semi-arid region of Northeast China

| PRJNA658451 | ENA

Expressional profile of liver of CGMCC No.8730 Eurotium cristatum fermented dark tea fed high-fat diet rats

Project description:Microbial fermentation is involved in the processing of a dark tea popular for centuries in Northwest China which has shown many health benefits. This study will examine anti-obesity, hyperlipidemic and hyperglycemic effects of CGMCC No.8730 Eurotium cristatum (EC) fermented dark tea (8730DT).

2019-07-14 | GSE84496 | GEO

Global transcriptome analysis of gene expression changes in Mesorhizobium alhagi CCNWXJ12-2 under salt stress

Project description:Analysis of gene expression changes of Mesorhizobium alhagi CCNWXJ12-2 under high salt stress. Mesorhizobium alhagi CCNWXJ12-2 is isolated from Alhagi sparsifolia in northwest of China. Total RNA extracted from Mesorhizobium alhagi CCNWXJ12-2 growing in TY medium containing 0.4 M NaCl and 0 M NaCl.

2014-05-06 | E-GEOD-57306 | biostudies-arrayexpress

soil metagenome

Project description:microbial community in arid and semi-arid desert

| PRJDB11638 | ENA

Project description:SSU sequences from a semi-arid region plant and soil samples

| PRJNA481066 | ENA

soil metagenome

Project description:Semi arid steppe soil Metagenome

| PRJNA194082 | ENA

16S rRNA amplicon sequences of bacterial communities

Project description:16S rRNA amplicon sequences from a 5th order mountain stream network, Oregon, USA

| PRJNA534507 | ENA