Ontology highlight
ABSTRACT:
PROVIDER: PRJNA777784 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
2021-10-15 | E-MTAB-9686 | biostudies-arrayexpress
Project description:The gut microbiome is known to be sensitive to changes in the immune system, especially during autoimmune diseases such as Multiple Sclerosis (MS). Our study examines the changes to the gut microbiome that occur during Experimental Autoimmune Encephalomyelitis (EAE), an animal model for MS. We collected fecal samples at key stages of EAE progression and quantified microbial abundances with 16S V4 amplicon sequencing. Our analysis of the data suggests that commensal Lactobacillaceae fall in abundance during EAE while other commensal populations belonging to the Clostridiaceae, Ruminococcaceae, and Peptostreptococcaceae families expand. Community analysis with microbial co-occurrence networks points to these three taxa as mediators of gut microbiome dysbiosis. We also employed PICRUSt2 to impute MetaCyc Enzyme Consortium (EC) pathway abundances from the original microbial abundance data. From this analysis, we found that a number of imputed EC pathways responsible for the production of compounds with indole groups are enriched in mice undergoing EAE. Our analysis and interpretation of results provides a detailed picture of the changes to the gut microbiome that are occurring throughout the course of EAE disease progression.
2020-09-15 | GSE153118 | GEO