Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Amplicon sequencing of marine samples from Sydney Harbour including 16S and 18S markers

PROVIDER: PRJNA830687 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR18904900_1.fastq.gz	Fastqsanger.gz
	SRR18904900_2.fastq.gz	Fastqsanger.gz
	SRR18905000_1.fastq.gz	Fastqsanger.gz
	SRR18905000_2.fastq.gz	Fastqsanger.gz
	SRR18904901_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 260

Similar Datasets

Project description:Sydney Harbour metagenomes

| PRJEB6374 | ENA

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Project description:Sydney Harbour microbial community

| PRJNA827923 | ENA

Sydney Harbour study

Project description:Sydney Harbour microbial diversity study

| PRJEB24122 | ENA

16s RNA sequencing data from environmental and steel corrosion samples, Shoreham Harbour, UK

Project description:16s RNA gene sequencing data from seawater, bed sediment and steel corrosion samples from Shoreham Harbour, UK, collected to allow bacterial species comparisons between microbially influenced corrosion, the surrounding seawater, and the sea bed sediment at the seafloor and 50cm depth below seafloor.

2019-10-06 | E-MTAB-8373 | biostudies-arrayexpress

aquatic metagenome

Project description:Tolo Harbour 18S rDNA amplicon Targeted Locus (Loci)

| PRJNA219227 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

marine metagenome

Project description:Sydney Harbour Microbiome Targeted loci environmental

| PRJNA305669 | ENA

Project description:Phytoplankton composition in Sydney Harbour estuary

| PRJNA491799 | ENA

Sydney Harbour microbial eukaryotes

Project description:Seasonal and rainfall study of Sydney Harbour

| PRJEB24030 | ENA