Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Bacteria

ABSTRACT: Microbiota in oral saliva samples by 16S rDNA v3-V4 target amplicon sequencing Raw sequence reads

PROVIDER: PRJNA862307 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR20737100_1.fastq.gz	Fastqsanger.gz
	SRR20737100_2.fastq.gz	Fastqsanger.gz
	SRR20737101_1.fastq.gz	Fastqsanger.gz
	SRR20737101_2.fastq.gz	Fastqsanger.gz
	SRR20737102_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 96

Similar Datasets

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

First exploration of the altered microbial gut-lung axis in the pathogenesis of human refractory chronic cough

Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.

2024-04-17 | GSE240646 | GEO

Bacteria

Project description:16S rRNA V3-V4 sequencing of oral (saliva) microbiome isolated from healthy females and males

| PRJDB14548 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

7a75f7bd-831c-4b1a-9a69-e36963fb9e78 - samples

Project description:Amplicon sequencing from 45 samples - Amplicons of 16s v3-v4

| EGAD00001005027 | EGA

food fermentation metagenome

Project description:16S V3-V4 amplicon sequencing

| PRJDB9082 | ENA

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Microbiota

Project description:16S rDNA V3-V4 of patients

| PRJNA1057060 | ENA

582f7f57-cdc9-4840-91d7-9e2e97e1f33a - samples

Project description:16S rRNA gene V3-V4 region sequenced from 15 saliva samples of farmers from Palanan (Philippines)

| EGAD00001007727 | EGA

e185bdec-e87c-474e-9e6c-590de1e4be24 - samples

Project description:16S rRNA gene V3-V4 region sequenced from 148 saliva samples of Agta hunter-gatherers from Philippines.

| EGAD00001007726 | EGA