Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S V3-V4 sequence of mouse stool microbiota

PROVIDER: PRJNA879290 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR21528900_1.fastq.gz	Fastqsanger.gz
	SRR21528900_2.fastq.gz	Fastqsanger.gz
	SRR21528901_1.fastq.gz	Fastqsanger.gz
	SRR21528901_2.fastq.gz	Fastqsanger.gz
	SRR21528902_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 24

Similar Datasets

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

First exploration of the altered microbial gut-lung axis in the pathogenesis of human refractory chronic cough

Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.

2024-04-17 | GSE240646 | GEO

Multi-modal single cell analysis reveals gut microbiota reshapes brain immune landscape in aged mouse model.

Project description:We used 16S V3/V4 region amplification to evaluate the composition of bacteria species in mouse fecal pellets. Fecel pellets were collected from young-adult (12 weeks old) wild type C57Bl/6 mice and aged (72 weeks old) wild type C57Bl/6 mice after 21 days of vehicle or antibiotics treatment (to induce gut microbiota depletion). In one sequencing round, we sequenced a total of 12 different fecal samples (3 young control, 3 aged control, 3 young depleted gut microbiota (ABX) and 3 aged depleted gut microbiota (ABX)). Amplicons were indexed using the Nextera XT Index Kit and pooled into a library for Illumina sequencing.

2020-11-03 | GSE160628 | GEO

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Mouse caecum vs faeces - Metaproteogenomics Reveals Taxonomic and Functional Changes between Cecal and Fecal Microbiota in Mouse

Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.

2017-03-31 | PXD004911 | Pride

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

2013-06-25 | E-GEOD-42426 | biostudies-arrayexpress