Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: High throughput sequencing of the 16S rRNA of the pre -pit fermentation grain samples

PROVIDER: PRJNA898131 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR22188206_1.fastq.gz	Fastqsanger.gz
	SRR22188206_2.fastq.gz	Fastqsanger.gz

Items per page:

1 - 2 of 2

Similar Datasets

Project description:High throughput sequencing of the 16S rRNA of the pre -pit fermentation grain samples

| PRJNA898829 | ENA

Project description:High throughput sequencing of the itsof the pre -pit fermentation grain samples

| PRJNA898250 | ENA

Project description:16S rRNA of the pre -pit fermentation grain samples from round 7

| PRJNA898146 | ENA

Project description:High throughput sequencing of the 16S rRNA of the grain samples

| PRJNA898143 | ENA

Project description:High throughput sequencing of the 16S rRNA of the grain samples during sauce-flavor baijiu fermentation

| PRJNA735038 | ENA

Structural and functional changes in prokaryotic communities in artificial pit mud during Chinese Baijiu production

Project description:The fermented and distilled Chinese alcoholic beverage strong flavor baijiu (SFB) gets its characteristic flavor during fermentation in cellars lined with pit mud. Microbes in the pit mud produce many key precursors of flavor esters. The over 20 year maturation time of natural pit mud have promoted attempts to produce artificial pit mud (APM) with shorter maturation time. However, knowledge on the molecular basis of APM microbial dynamics and associated functional variation during SFB brewing is limited, and the role of this variability in high quality SFB production remains poorly understood. We studied APM maturation in new cellars till the fourth brewing batch using 16S rRNA gene amplicon sequencing, real-time quantitative PCR and function prediction based on the sequencing results, and metaproteomics and metabolomics techniques. The results provide insight into global APM prokaryotic dynamics and their role in SFB production, which will be helpful for further optimization of APM culture technique and improvement of SFB quality.

2020-03-10 | PXD016140 |

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

Project description:16S rRNA High-Throughput Sequencing

| PRJNA464196 | ENA