Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
| 2255499 | ecrin-mdr-crc
Project description:High throughput sequencing of the 16S rRNA of the pre -pit fermentation grain samples
| PRJNA898829 | ENA
Project description:High throughput sequencing of the 16S rRNA of the pre -pit fermentation grain samples
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
Project description:We aimed to investigate the microbial community composition in patients with intracerebral hemorrhage (ICH) and its effect on prognosis. The relationship between changes in bacterial flora and the prognosis of spontaneous cerebral hemorrhage was studied in two cohort studies. Fecal samples from healthy volunteers and patients with intracerebral hemorrhage were subjected to 16S rRNA sequencing at three time points: T1 (within 24 hours of admission), T2 (3 days post-surgery), and T3 (7 days post-surgery) using Illumina high-throughput sequencing technology.