Similar Datasets
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.
2013-06-25 | GSE42426 | GEO
Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
2023-10-15 | GSE216589 | GEO
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach. Phylogenetic study of the Treponema taxa found in digital dermatitis lesions of Holstein cows.
2013-06-25 | E-GEOD-42426 | biostudies-arrayexpress
Project description:16S Amplicon sequencing of northwestern argentinian artisanal cheeses gDNA using V4 primers
| PRJEB24792 | ENA
Project description:mRNAs of siCTRL, siNSUN2 and ALYREF-RIP HeLa cells, and multiple mouse tissues were purified using oligo (dT)-conjugated magnetic beads followed by RiboMinus treatement. mRNAs were fragmented to ~200 nt and treated by Sodium bisulfite solution (pH 5.1) containing Hydroquinone. Bisulfite treated mRNAs were reverse transcribed to cDNA using ACT random hexamer primers. The cDNAs were subjected to libraries construction using KAPA Stranded mRNA-Seq Kit (KAPA) and performed sequencing on HiSeq2500 (Illumina) in pair-end mode, creating reads with a length of 125 bp. Sequencing chemistry v4 (Illumina) was used and every sample was sequenced at one lane.
2017-04-19 | GSE93749 | GEO
Project description:Bacterial 16S V4 rDNA was amplified using two differently barcoded V4 fusion primers. Pooled PCR samples were purified and paired-end sequenced on MiSeq instrument for 250 cycles. The steps from DNA quantification to sequencing were conducted at Second Genome Inc.
| EGAD00001005482 | EGA
Project description:The total HeLa cell transcriptome analysis was carried out using Illumina HumanHT-12 v4 Expression BeadChip array. RNA was isolated from cultures of wild-type (Cas9 GLTP control) and three different GLTP gene KO clones. 100 ng of total RNA was primed using oligo-dT(T7) primers and converted to cDNA with Invitrogen SuperScript III Reverse Transcriptase. The double-stranded cDNA template was amplified and labeled with in vitro transcription to generate multiple copies of biotinylated cRNA. Purified biotinylated cRNA was hybridized to HumanHT-12 v4 expression beadchips for 18 h at 58 °C using a rocking platform at speed 5. Beadchips were washed, blocked, stained with streptavidin-Cy3, and scanned with an Illumina iScan scanner, using the manufacturer’s recommended protocols. The raw data were extracted using Illumina’s GenomeStudio software.
2022-08-31 | E-MTAB-12118 | biostudies-arrayexpress
Project description:Monocyte-derived macrophages were stimulated with 25 ng/ml of the indicated IFNs or infected with HIV-1-BaL-HSA. Total RNA was isolated 18 h following stimulation/infection using RNeasy minikit (Qiagen). Intact poly(A) RNA was purified from total RNA samples (100 to 500 ng) with oligo(dT) magnetic beads, and stranded mRNA sequencing libraries were prepared as described using the Illumina TruSeq Stranded mRNA Library Preparation kit (catalog no. RS-122-2101 and RS-122-2102). Purified libraries were qualified on an Agilent Technologies 2200 TapeStation using a D1000 ScreenTape assay (catalog no. 5067-5582 and 5067-5583). The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant kit (catalog no. KK4824). Individual libraries were normalized to 10 nM, and equal volumes were pooled in preparation for Illumina sequence analysis. Sequencing libraries (25 pM) were chemically denatured and applied to an Illumina HiSeq v4 single-read flow cell using an Illumina cBot system. Hybridized molecules were clonally amplified and annealed to sequencing primers with reagents from an Illumina HiSeq SR cluster kit v4-cBot (catalog no. GD-401-4001). Following transfer of the flow cell to an Illumina HiSeq 2500 instrument (HCSv2.2.38 and RTA v1.18.61), a 50-cycle single-read sequence run was performed using HiSeq SBS kit v4 sequencing reagents (catalog no. FC-401-4002).
2020-10-02 | GSE158434 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO