Project description:Age-dependent changes of the gut-associated microbiome have been linked to increased frailty and systemic inflammation. This study found that age-associated changes of the gut microbiome of BALB/c and C57BL/6 mice could be reverted by co-housing of aged (22 months old) and adult (3 months old) mice for 30-40 days or faecal microbiota transplantation (FMT) from adult into aged mice. This was demonstrated using high-throughput sequencing of the V3-V4 hypervariable region of bacterial 16S rRNA gene isolated from faecal pellets collected from 3-4 months old adult and 22-23 months old aged mice before and after co-housing or FMT.
Project description:Pouchitis is a common complication for ulcerative colitis (UC) patients with ileal pouch-anal anastomosis (IPAA) surgery. Similarly to IBD, both innate host factors such as genetics, and environmental stimuli including the tissue-associated microbiome have been implicated in the pathogenesis. In this study, we make use of the IPAA model of inflammatory bowel disease (IBD) to carry out a study associating mucosal host gene expression with the microbiome and corresponding clinical outcomes. In order to determine how host gene expression might influence, or be influenced by the tissue associated microbiome, we analyzed 205 IPAA patients with biopsies collected from the pouch and afferent limb for host transcriptomics and 16S rDNA gene sequencing. Metadata included antibiotic use, inflammation score, and clinical classification. To achieve power for a genome-wide microbiome-transcriptome association study, we used principal component analysis to reduce OTUs and host transcripts to eigengenes and eigenclades explaining 50% of observed variance. These were subsequently tested for significant covariation with one another and/or outcome using multivariate linear modeling.
Project description:In a prior report, we observed two distinct lung microbiomes in healthy subjects that we termed â??pneumotypesâ??: pneumotypeSPT, characterized by high bacterial load and supraglottic predominant taxa (SPT) such as the anaerobes Prevotella and Veillonella; and pneumotypeBPT, with low bacterial burden and background predominant taxa (BPT) found in the saline lavage and bronchoscope. Here, we determined the prevalence of these two contrasting lung microbiome types, in a multi-center study of healthy subjects. We confirmed that a lower airway microbiome enriched with upper airway microbes (pneumotypeSPT) was present in ~45% of healthy individuals. Cross-sectional Multicenter cohort. BAL of 49 healthy subjects from three cohort had their lower airway microbiome assessed by 16S rDNA sequencing and microbial gene content (metagenome) was computationally inferred from taxonomic assignments. The amplicons from total 100 samples are barcoded; the barcode and other clinical characteristics (e.g. inflammatory biomarkers and metabolome data) for each sample are provided in the 'Pneumotype.sep.Map.A1.txt' file.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.