Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1087593 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Fecal samples collected on day 5 from randomly selected colitic SD rats were analyzed for gut microbiota by sequencing the V4 region of the 16S rRNA gene. The orally administered Dex-P-laden NPA2 coacervate (Dex-P/NPA2) significantly restores the diversity of gut microbiota compared with colitic SD rats in the Dex-P/PBS group and the untreated colitic rats (Control).
2021-11-06 | GSE167138 | GEO
Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.
2013-06-25 | GSE42426 | GEO
Project description:To effectively monitor microbial populations in acidic environments and bioleaching systems, a comprehensive 50-mer-based oligonucleotide microarray was developed based on most of the known genes associated with the acidophiles. This array contained 1,072 probes in which there were 571 related to 16S rRNA and 501 related to functional genes. Acid mine drainage (AMD) presents numerous problems to the aquatic life and surrounding ecosystems. However, little is known about the geographic distribution, diversity, composition, structure and function of AMD microbial communities. In this study, we analyzed the geographic distribution of AMD microbial communities from twenty sites using restriction fragment length polymorphism (RFLP) analysis of 16S rRNA genes, and the results showed that AMD microbial communities were geographically distributed and had high variations among different sites. Then an AMD-specific microarray was used to further analyze nine AMD microbial communities, and showed that those nine AMD microbial communities had high variations measured by the number of detected genes, overlapping genes between samples, unique genes, and diversity indices. Statistical analyses indicated that the concentrations of Fe, S, Ca, Mg, Zn, Cu and pH had strong impacts on both phylogenetic and functional diversity, composition, and structure of AMD microbial communities. This study provides insights into our understanding of the geographic distribution, diversity, composition, structure and functional potential of AMD microbial communities and key environmental factors shaping them. This study investigated the geographic distribution of Acid Mine Drainages microbial communities using a 16S rRNA gene-based RFLP method and the diversity, composition and structure of AMD microbial communities phylogenetically and functionally using an AMD-specific microarray which contained 1,072 probes ( 571 related to 16S rRNA and 501 related to functional genes). The functional genes in the microarray were involved in carbon metabolism (158), nitrogen metabolism (72), sulfur metabolism (39), iron metabolism (68), DNA replication and repair (97), metal-resistance (27), membrane-relate gene (16), transposon (13) and IST sequence (11).
2011-03-08 | E-GEOD-27542 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:18S-V4 metabarcoding of haptophytes in the Kuroshio region
| PRJDB13340 | ENA
Project description:16S rDNA V4 region amplicon sequencing of mice colonic microbiota
| PRJDB4266 | ENA