Ontology highlight
ABSTRACT:
PROVIDER: PRJNA915331 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Over 2000 publicly accessible human and mouse ChIP-Seq datasets for about 250 Transcription Factors and chromatin complexes from various databases (ENCODE, GEO) were mapped to custom-made human and mouse genomes containing a reference rDNA sequence of the appropriate species (Genbank U13369.1 for human, BK000964.3 for mouse). The read mapping density across the rDNA sequence was then extracted and normalized to the median in that dataset. Unbiased clustering and analysis, followed by curation, was performed to identify high-confidence patterns of rDNA occupancy for numerous hematopoietic TFs and TF families at canonical TF motif sequences. ************************ Data processing steps: FASTQs were trimmed using Trimmomatic with the following parameters: LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:30 Reads were mapped to customized genomes (containing additional rDNA sequence) using Bowtie2 using the following parameter: -X 2000 Read density across the rDNA sequence was extracted using igvtools ************************
2022-01-15 | GSE191272 | GEO
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.
2019-12-03 | GSE121413 | GEO
Project description:Transcription of the >200 rRNA genes (rDNA) by RNA Polymerase I (RPI) determines as much as 35% of total nuclear RNA synthesis and is a major determinant of cell growth implicated in a range of hypertrophic and developmental disorders. Activation of the rDNA involves the formation of an extended nucleosome free region (NFR) by the multi-HMGbox factor UBTF, which is also implicated with the RPI specific TBP-TAFI factor SL1 in preinitiation complex formation. However, neither factor alone displays significant DNA sequence binding specificity. Here we show that in cell cooperation between SL1 and the UBTF1 splice variant creates the sequence specificity required for promoter recognition. While both UBTF1 and UBTF2 splice variants bind throughout the rDNA NFR, only UBTF1 binds at the rDNA promoters. Conditional deletion of the Taf1b subunit of SL1 depleted UBTF1 from the rDNA promoters but not from elsewhere across the rDNA NFR. We show RPI promoters are particularly poor binding sites for UBTF and suggest an induced-fit model in which promoter-specific remodelling by UBTF1 creates high affinity sites for SL1 binding. A mouse model of the UBTF-E210K pediatric neurodegeneration syndrome suggests this mutation affects cooperativity of UBTF-SL1 promoter recruitment and further supports the induced-fit model.
2022-02-03 | E-MTAB-11385 | biostudies-arrayexpress
Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.
2019-12-05 | GSE121417 | GEO
Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected inside IGS. Our data indicate that mostly rDNA units exhibit close proximity with pericentromeric regions in different chromosomes. We also detected the contacts within a rDNA unit and between rDNA units. Examination of rDNA genome-wide contacts in HEK 293T cells using 4C approach.
2014-10-04 | E-GEOD-49193 | biostudies-arrayexpress
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in hESM01 cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.
2021-08-11 | GSE175909 | GEO
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).
2022-12-01 | GSE121363 | GEO
Project description:Until now, it has been reasonably assumed that specific base-pair recognition is the only mechanism controlling the specificity of transcription factor (TF)M-bM-^HM-^RDNA binding. Contrary to this assumption, here we show that nonspecific DNA sequences possessing certain repeat symmetries, when present outside of specific TF binding sites (TFBSs), statistically control TFM-bM-^HM-^RDNA binding preferences. We used high-throughput proteinM-bM-^HM-^RDNA binding assays to measure the binding levels and free energies of binding for several human TFs to tens of thousands of short DNA sequences with varying re- peat symmetries. Based on statistical mechanics modeling, we iden- tify a new proteinM-bM-^HM-^RDNA binding mechanism induced by DNA se- quence symmetry in the absence of specific base-pair recognition, and experimentally demonstrate that this mechanism indeed gov- erns proteinM-bM-^HM-^RDNA binding preferences. Four custom protein binding microarray (PBM) experiments of human transcription factors were performed. Briefly, the PBMs involved binding his-tagged transcription factors c-Myc, Max, and Mad1(Mxd1) to double-stranded 180K Agilent microarrays in order to determine their binding specificity for GTCACGTGAC DNA binding sites flanked by repetitive DNA elements with different symmetries and correlation length scales. Briefly, we represent three categories of 36-bp sequences: 1) 28800 probes centered at a GTCACGTGAC site and flanked by repetitive elements (probe names starting with Ariel_); 2) Unbound probes (or negative controls); and 3) Bound probes, which correspond to randomly selected genomic regions bound in vivo by c-Myc, Max, or Mad2 (ChIP-seq P < 10^(-10) in HeLaS3 or K562 celld (ENCODE)), which contain at least two consecutive 8-mers with universal PBM E-score > 0.4 (Munteanu and Gordan, LNCS 2013). Each DNA sequence represented on the array is present in 6 replicate spots. We report the gcPBM signal intensity for each spot (raw files) as well as the median intensity over the 6 replicate spots (normalized data). The PBM protocol is described in Berger et al., Nature Biotechnology 2006 (PMID 16998473).
2014-10-01 | E-GEOD-61920 | biostudies-arrayexpress