Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: soil in different treatment 16S rRNA gene high-throughput sequencing Raw sequence reads

PROVIDER: PRJNA934133 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR23457200_1.fastq.gz	Fastqsanger.gz
	SRR23457200_2.fastq.gz	Fastqsanger.gz
	SRR23457201_1.fastq.gz	Fastqsanger.gz
	SRR23457201_2.fastq.gz	Fastqsanger.gz
	SRR23457202_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 216

Similar Datasets

Project description:soil in different treatment 18S rRNA gene high-throughput sequencing Raw sequence reads

| PRJNA934129 | ENA

Microbial diversity of an uncontaminated and a 2,4,6-TNT contaminated soil sample with CodeLink microarrays

Project description:Comparison of probe-target dissociations of probe Eub338 and Gam42a with native RNA of P. putida, in vitro transcribed 16s rRNA of P. putida, in vitro transcribed 16S rRNA of a 2,4,6-trinitrotoluene contaminated soil and an uncontaminated soil sample. Functional ANOVA revealed no significant differences in the dissociation curves of probe Eub338 when hybridised to the different samples. On the opposite, the dissociation curve of probe Gam42a with native RNA of P. putida was significantly different than the dissociation curves obtained with in vitro transcribed 16S rRNA samples. Keywords: Microbial diversity, thermal dissociation analysis, CodeLink microarray

2005-11-05 | GSE3525 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:soil 16S rRNA high-throughput sequencing

| PRJNA776560 | ENA

A phylogenetic microarray targeting 16S rRNA genes from the bacterial division Acidobacteria

Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction A ten chip study using PCR amplicons from cloned 16S rRNA genes and from diverse soil 16S rRNAs, with PCR primers specific to the Division Acidobacteria. Each chip measures the signal from 42,194 probes (in triplicate) targeting Acidobacteria division, subdivision, and subclades as well as other bacterial phyla. All samples except one (GSM464591) include 2.5 M betaine in the hybridization buffer. Pair files lost due to a computer crash.

2010-06-24 | E-GEOD-18711 | biostudies-arrayexpress

A phylogenetic microarray targeting 16S rRNA genes from the bacterial division Acidobacteria

2010-01-01 | GSE18711 | GEO

Project description:high-throughput sequencing soil 16S rRNA gene

| PRJNA800347 | ENA

Morus alba Raw protein sequence reads

Project description:Morus alba L. Raw protein sequence reads and sequence

2024-02-08 | PXD049451 |

Specific modulation of HIV RNA splicing and upregulation of anti-inflammatory miR-124 by the new drug candidate ABX464

Project description:Purpose: To ensure that ABX464 acted specifically on HIV splicing and did not significantly or globally affect the splicing events of human genes, we used a high-throughput RNAseq approach. Many genome-wide expression studies of HIV infection are based on analyses of total peripheral blood mononuclear cells (PBMCs), which consist of over a dozen cell subsets, including T cells, B cells, NK cells and monocytes Methods: The CD4 T cells were uninfected or infected with the YU2 strain and were untreated or treated for 6 days with ABX464, followed by high-throughput RNAseq. Each raw dataset of the samples contained between 44 and 105 million single-end reads (50 bp), with an average of approximately 60 million raw reads per sample Results: Approximately 98% of the total raw reads were mapped to the human genome sequence (GRCh38), giving an average of 60 million human reads per sample for further analyses. The reads that were correctly mapped (approximately 98% of total input reads) to the gene and transcript locations (GTF annotation file) Conclusions: The MDS of our gene expression data showed, without any outliers, that the different donors segregated well and distributed into the DMSO (untreated) and ABX464 treatments that were infected or uninfected. The displayed variance was donor-dependent (clustered by donor) but treatment-independent (no data structure related to the different treatments), which suggests that the ABX464 molecule did not induce a major difference in CD4 T cell gene expression.

2018-06-22 | GSE116073 | GEO

Project description:High-throughput sequencing of soil 16S rRNA amplicons

| PRJNA909080 | ENA