Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

65 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gastrointestinal stromal tumor GIST: gene expresssion and ChIP analyses

ABSTRACT: This SuperSeries is composed of the following subset Series: GSE19396: ETV1 knockdown in GIST cell lines GSE22433: Imatinib Treatment of GIST882 GSE22441: Mapping of ETV1 genomic binding sites in gastrointestinal stromal tumor (GIST). Refer to individual Series

ORGANISM(S): Homo sapiens

SUBMITTER: Yu Chen

PROVIDER: E-GEOD-22852 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours.

Chi Ping P Chen Yu Y Zhang Lei L Guo Xingyi X Wongvipat John J Shamu Tambudzai T Fletcher Jonathan A JA Dewell Scott S Maki Robert G RG Zheng Deyou D Antonescu Cristina R CR Allis C David CD Sawyers Charles L CL

Nature 20101003 7317

Gastrointestinal stromal tumour (GIST) is the most common human sarcoma and is primarily defined by activating mutations in the KIT or PDGFRA receptor tyrosine kinases. KIT is highly expressed in interstitial cells of Cajal (ICCs)-the presumed cell of origin for GIST-as well as in haematopoietic stem cells, melanocytes, mast cells and germ cells. Yet, families harbouring germline activating KIT mutations and mice with knock-in Kit mutations almost exclusively develop ICC hyperplasia and GIST, su ...[more]

PMID: 20927104

Similar Datasets

ETV1 knockdown in GIST cell lines

Project description:ETV1 is highly expressed in GIST cells and required for their survival and growth. To identify genes and pathways regulated by ETV1 in GIST, we performed expression profiles of GIST cells after ETV1 knockdown. Two GIST cell lines (GIST48 and GIST882) were infected in duplicate with three shRNA viruses (Scrambled, ETV1sh1-B11TRCN0000013923, ETV1sh2-TRCN0000013925). Four days after infection, RNA was harvested for expression profiling.

2010-10-13 | E-GEOD-19396 | biostudies-arrayexpress

Imatinib Treatment of GIST882

Project description:Gastrointestinal Stromal Tumor frequently harbor mutations in the KIT receptor tyrosine kinase and depend on its activity for growth. This underlies the efficacy of imatinib, a inhibitor of KIT activity, in GIST management. GIST882 is a patient derived GIST cell line that harbor a K640E exon 13 KIT mutation and is sensitive to imatinib treatment. To analyze the downstream effect of KIT inhibition, GIST882 cells were treated for 8 hours with 1Î¼M Imatinib. GIST882 cells were treated in triplicate with 0.1% DMSO or 1Î¼M Imatinib for 8 hours. RNA was isolated and analyzed by Illumina Human HT-12 beadarray.

2010-10-13 | E-GEOD-22433 | biostudies-arrayexpress

H3K4me3 Interactions with TAF3 Regulate Preinitiation Complex Assembly and Selective Gene Activation [Illumina BeadArray]

Project description:Histone modifications regulate chromatin-dependent processes, yet the mechanisms by which they contribute to specific outcomes remain unclear. H3K4me3 is a prominent histone mark that is associated with active genes and promotes transcription through interactions with effector proteins that include initiation factor TFIID. We demonstrate that H3K4me3-TAF3 interactions direct global TFIID recruitment to active genes, some of which are p53 targets. Further analyses show that (i) H3K4me3 enhances p53-dependent transcription by stimulating preinitiation complex (PIC) formation; (ii) H3K4me3, through TAF3 interactions, can act either independently or cooperatively with the TATA box to direct PIC formation and transcription; and (iii) H3K4me3-TAF3/TFIID interactions regulate gene-selective functions of p53 in response to genotoxic stress. Our findings indicate a mechanism by which H3K4me3 directs PIC assembly for the rapid induction of specific p53 target genes. Total RNAs from control or TAF3 knockdown cells before and after doxorubicin treatment were subjected to Illumina microarray analyses.

2013-03-02 | E-GEOD-43541 | biostudies-arrayexpress

PTEN intact and NULL prostates in intact and castrate mice.

Project description:We performed expression profiling of prostates of 3 month wild-type and PTEN NULL mice and assessed the response to 3 days of castration. Seven three month old WT and PbCre x PTEN f/f (PTEN NULL) mice were used. They are in the C57B6 background. Three mice in each group were castrated. Three days after castration, the prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.

2011-05-19 | E-GEOD-24691 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

H3K4me3 Interactions with TAF3 Regulate Preinitiation Complex Assembly and Selective Gene Activation

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2013-03-02 | E-GEOD-43542 | biostudies-arrayexpress

ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2013-05-30 | E-GEOD-47220 | biostudies-arrayexpress

Response to catration in PTEN null and PTEN null ERG expressing mouse prostates

Project description:We performed expression mouse profiling of prostates of 3 month PTEN f/f and Pten f/f;R26(ERG) mice and assessed the response to 3 days of castration. Mice are in the C57B6 background. Two mice in each group were castrated. Three days after castration, the prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.

2013-04-25 | E-GEOD-46360 | biostudies-arrayexpress

Expression profile of Pten loss and ERG overexpression in mouse prostate

Project description:We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice. For WT and ERG prostates, entire prostates were dissected and total RNA immediated harvested. For Pten f/f and Pten f/f;ERG prostates, the Ventral Lobe was dissected. Mice are in the C57B6 background. The prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.

2013-05-10 | E-GEOD-46799 | biostudies-arrayexpress

RNA-Seq of murine GIST-like tumors after Etv1 ablation

Project description:We used a mouse expressing three alleles 1) KitV558Delta/+ activating allele that develop GIST-like tumors in the cecum, 2) Etv1 flox/flox conditional knockout allele and 3) Rosa26-CreERT2 tamoxifen activated Cre allele. Mice were treated with either Tamoxifen (to delete Etv1) or corn oil (control). Cecal tumors were isolated for gene expression profiling by RNA-Seq. Expression profile mouse cecal GIST tumor with or without Etv1 ablation was generated by RNA-Seq

2015-01-01 | E-GEOD-64608 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data