Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Profiling of Argonaute (AGO) 2-associated sRNAs after infection of bacterial pathogen Pseudomonas syringae

ABSTRACT: Transgenic Arabidopsis plants (AGO2::HA:AGO2) were treated with either mock (10 mM MgCl2) or Pseudomonas syringae pv. tomato (Pst) expressing avrRpt2 (R2) at a concentration of 2 x 107 cfu/ml for 14 hours. sRNAs associated with AGO1 and AGO2 were co-immunoprecipitated using antibodies against either AGO1 (AGO1-IP), or HA (hemagglutinin) (AGO2-IP). As controls, we also gel-purified the 18-28 nt fraction of the total RNAs from an AGO2 mutant (ago2-1). The co-immunoprecipitated or gel-purified RNAs were cloned and sequenced by Illumina deep sequencing.

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE26161 | GEO | 2011/05/10

SECONDARY ACCESSION(S): PRJNA135281

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Profiling of Argonaute (AGO) 2-associated sRNAs after infection of bacterial pathogen Pseudomonas syringae

Project description:Transgenic Arabidopsis plants (AGO2::HA:AGO2) were treated with either mock (10 mM MgCl2) or Pseudomonas syringae pv. tomato (Pst) expressing avrRpt2 (R2) at a concentration of 2 x 107 cfu/ml for 14 hours. sRNAs associated with AGO1 and AGO2 were co-immunoprecipitated using antibodies against either AGO1 (AGO1-IP), or HA (hemagglutinin) (AGO2-IP). As controls, we also gel-purified the 18-28 nt fraction of the total RNAs from an AGO2 mutant (ago2-1). The co-immunoprecipitated or gel-purified RNAs were cloned and sequenced by Illumina deep sequencing. Examination of AGO-associated sRNAs in pathogen-treated or control plants

2011-05-10 | E-GEOD-26161 | biostudies-arrayexpress

Ago1 vs Ago2-IP small RNA deep-sequencing with age in Drosophila

Project description:Drosophila miRNAs show distinct change in isoform distribution pattern with age. Some miRNAs show accumulation of the short isoforms, while other miRNAs show the accumulation of the long isoforms with age. The increase of the long isoforms of some miRNAs reflects increased 2'-O-methylated miRNA isoforms with age. The increase in 2'-O-methylated miRNA isoforms reflected increased Ago2-loading, but not Ago1-loading of specific miRNA isoforms with age. This raised a question on whether there is global shift in small RNA loading pattern between Ago1 and Ago2 with age. To investigate change in small RNA loading pattern between Ago1 and Ago2 with age, we performed small RNA deep-sequencing of Ago1 vs Ago2-IP small RNAs at 3d and 30d in Drosophila. This analysis revealed global increase of miRNA loading into Ago2, but not into Ago1 with age. 3d and 30d FLAG-HA-Ago2 male flies were collected. Ago1 and Ago2 were immunoprecipitated by anti-Ago1 and anti-FLAG M2 beads respectively. RNA was purified from the beads, P32-labeled, and small RNA fraction was gel-purififed. Small RNA libraries were prepared using Illumina's TruSeq small RNA sample preparation kit (#RS-200-0012, Illumina, Inc. San Diego, CA), following the manufacturer's protocol. The libraries were multiplexed and sequenced on HiSeq2000 platform (Illumina).

2014-01-01 | E-GEOD-52961 | biostudies-arrayexpress

Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.

Project description:Small RNA from total RNA (input fraction) and immunoprecipitated HA-AGO1-complexes (IP fraction) were identified using high-throughput sequencing-by-synthesis. Two replicate input fraction samples were used as controls for two replicate IP fraction samples. Total RNA from input fractions and small RNA that co-immunoprecipitated with HA-AGO1 complexes were size fractionated by polyacrylamide gel electrophoresis to recover 18-24 nucleotide small RNA. 3' and then 5' adaptors were serially ligated on to each small RNA followed by PAGE purification. RT-PCR was used to convert RNA to DNA amplicons. Amplicons were sequenced using the Illumina GAIIx platform. Resulting reads were parsed and mapped to the A. thaliana genome (TAIR9) using the CASHX pipeline.

2010-06-21 | E-GEOD-22252 | biostudies-arrayexpress

Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.

Project description:Small RNA from total RNA (input fraction) and immunoprecipitated HA-AGO1-complexes (IP fraction) were identified using high-throughput sequencing-by-synthesis.

2010-06-21 | GSE22252 | GEO

Effect of aging and dFOXO knockout on small RNA in Ago1 and Ago2 RNA-induced silencing complexes

Project description:To examine the effect of loss of dFOXO on Ago1 and Ago2 RISC loading in aging animals, we sequenced RNA immunoprecipitated from Ago1 and Ago2 RISC collected from whole wildtype (wDah) and dFOXO-null (dfoxoΔ94) flies at young (5 days) and old (35 days) age. dFOXO is a transcription factor that regulates Ago1 and Ago2 as well as lifespan.

2022-09-04 | GSE212492 | GEO

LIS1 RNA binding orchestartes the mechanosensitive properties of embryonic stem cells in AGO2 dependent and independent ways.

Project description:LIS1 immunoprecipitation in nuclear and cytoplasmic fractions of LIS1 Floxed/-, OE and WT embryonic stem cells. To identify AGO2 dependent and independent interactions LIS1 was immunoprecipitated in AGO1-4 knockout and doxycycline induced AGO2 mouse embryonic stem cells.

2023-07-20 | PXD033150 | Pride

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Mouse adult testes: Total RNA vs. IP RNA

Project description:RNAs that are enriched in AGO2 Immunoprecipitated (IP) products or PIWIL1 IP products were identified from mouse(BALB/C) adult testes by examine the ratio of total RNA signal intensity to AGO2 IP RNA or PIWIL1 IP RNA signal intensity.

2013-04-01 | GSE27582 | GEO

Nematostella vectensis argonautes

Project description:We performed Immuno precipitation using antibodies against Nematostella vectensis Argonauts proteins (i.e AGO1 and AGO2). Samples of the IP were analyzed by LC-MSMS in order to idetify the argonautes and prove antibodies specifity.

2020-10-14 | PXD011644 | Pride

Convergence of distinct RNA-silencing pathways on GW182/Tnrc6

Project description:The RNA-binding protein Trim71/Lin41 is a phylogenetically conserved developmental regulator that functions in mammalian stem cell reprogramming, brain development and cancer. Trim71 recognizes target mRNAs through hairpin motifs and silences them through molecular mechanisms that await identification. Deposited data are mass spectrometry data from immunoprecipitation experiments with endogenously tagged Trim71, Ago2, and Tnrc6a. Experiments are carried out in mouse embryonic stem cells (mESCs) and uncover reciprocal interactions of Trim71, Ago2, and Tnrc6a. Trim71 protein interactions are largely independent of Ago2 levels, but strongly depend on the presence of RNA. A second set of experiments is mass spectrometry data from immunoprecipitation experiments in mESCs overexpressing a tagged peptide derived from Homo sapiens TNRC6B (‘FLAG-HA::T6BWT::Cherry’), that is known to block the Tnrc6-Ago2 interaction. We show that a wild-type version strongly binds Ago1 and Ago2, but not Trim71, while a mutant version binds neither Ago1, 2, nor Trim71.

2023-07-04 | PXD034537 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data