Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
PROVIDER: GSE22252 | GEO | 2010/06/21
SECONDARY ACCESSION(S): PRJNA128651
REPOSITORIES: GEO
Similar Datasets
Project description:Small RNA from total RNA (input fraction) and immunoprecipitated HA-AGO1-complexes (IP fraction) were identified using high-throughput sequencing-by-synthesis. Two replicate input fraction samples were used as controls for two replicate IP fraction samples. Total RNA from input fractions and small RNA that co-immunoprecipitated with HA-AGO1 complexes were size fractionated by polyacrylamide gel electrophoresis to recover 18-24 nucleotide small RNA. 3' and then 5' adaptors were serially ligated on to each small RNA followed by PAGE purification. RT-PCR was used to convert RNA to DNA amplicons. Amplicons were sequenced using the Illumina GAIIx platform. Resulting reads were parsed and mapped to the A. thaliana genome (TAIR9) using the CASHX pipeline.
2010-06-21 | E-GEOD-22252 | biostudies-arrayexpress
Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses. AGO1-DDH (wild type) AGO1-DAH (slicer mutant) proteins were immunoprecipitated (N-terminal 3xHA) from Arabidopsis (Columbia) flower (stages 1-12) lysate. Immunoprecipitate fractions were treated with nuclease P1 before cleanup to trim free RNA ends, and therefore enrich samples in AGO1 target sites. All samples were treated with Ribominus (Life Technologies) to reduce ribosomal RNA abundance. Transcript fragments from two replicates of AGO1-DDH and AGO1-DAH immunoprecipitates were sequenced. Ribominus-treated total RNA (input controls) was also sequenced for each replicate.
2012-09-28 | E-GEOD-40256 | biostudies-arrayexpress
Project description:Transgenic Arabidopsis plants (AGO2::HA:AGO2) were treated with either mock (10 mM MgCl2) or Pseudomonas syringae pv. tomato (Pst) expressing avrRpt2 (R2) at a concentration of 2 x 107 cfu/ml for 14 hours. sRNAs associated with AGO1 and AGO2 were co-immunoprecipitated using antibodies against either AGO1 (AGO1-IP), or HA (hemagglutinin) (AGO2-IP). As controls, we also gel-purified the 18-28 nt fraction of the total RNAs from an AGO2 mutant (ago2-1). The co-immunoprecipitated or gel-purified RNAs were cloned and sequenced by Illumina deep sequencing.
2011-05-10 | GSE26161 | GEO
Project description:Transgenic Arabidopsis plants (AGO2::HA:AGO2) were treated with either mock (10 mM MgCl2) or Pseudomonas syringae pv. tomato (Pst) expressing avrRpt2 (R2) at a concentration of 2 x 107 cfu/ml for 14 hours. sRNAs associated with AGO1 and AGO2 were co-immunoprecipitated using antibodies against either AGO1 (AGO1-IP), or HA (hemagglutinin) (AGO2-IP). As controls, we also gel-purified the 18-28 nt fraction of the total RNAs from an AGO2 mutant (ago2-1). The co-immunoprecipitated or gel-purified RNAs were cloned and sequenced by Illumina deep sequencing. Examination of AGO-associated sRNAs in pathogen-treated or control plants
2011-05-10 | E-GEOD-26161 | biostudies-arrayexpress
Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses.
2012-09-28 | GSE40256 | GEO
Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses. AGO1-DDH (wild type) AGO1-DAH (slicer mutant) proteins were immunoprecipitated (N-terminal 3xHA) from Arabidopsis (Columbia) flower (stages 1-12) lysate. Immunoprecipitations were also done from control plants transformed with vector only. Small RNA from immunoprecipitate fractions of vector, AGO1-DDH and AGO1-DAH were sequenced.
2012-09-28 | E-GEOD-40258 | biostudies-arrayexpress
Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses.
2012-09-28 | GSE40258 | GEO
Project description:Characterization of AGO1 bound short RNAs from nuclear extracts of HeLaS3 cell line. Nuclei were isolated from HeLaS3 cells; a fraction of Nuclear lysates was harvsted and sequenced as the input samples. The rest of nuclear lysates were immunoprecipitated using AGO1 monoclonal antibodies or Isotype matched IgG. Following immunoprecipitation, RNA was extracted from AGO1 or control IgG IP for short RNA sequencing. Two independent biological replicates were carried out.
2015-05-17 | E-MTAB-2129 | biostudies-arrayexpress
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:Drosophila miRNAs show distinct change in isoform distribution pattern with age. Some miRNAs show accumulation of the short isoforms, while other miRNAs show the accumulation of the long isoforms with age. The increase of the long isoforms of some miRNAs reflects increased 2'-O-methylated miRNA isoforms with age. The increase in 2'-O-methylated miRNA isoforms reflected increased Ago2-loading, but not Ago1-loading of specific miRNA isoforms with age. This raised a question on whether there is global shift in small RNA loading pattern between Ago1 and Ago2 with age. To investigate change in small RNA loading pattern between Ago1 and Ago2 with age, we performed small RNA deep-sequencing of Ago1 vs Ago2-IP small RNAs at 3d and 30d in Drosophila. This analysis revealed global increase of miRNA loading into Ago2, but not into Ago1 with age. 3d and 30d FLAG-HA-Ago2 male flies were collected. Ago1 and Ago2 were immunoprecipitated by anti-Ago1 and anti-FLAG M2 beads respectively. RNA was purified from the beads, P32-labeled, and small RNA fraction was gel-purififed. Small RNA libraries were prepared using Illumina's TruSeq small RNA sample preparation kit (#RS-200-0012, Illumina, Inc. San Diego, CA), following the manufacturer's protocol. The libraries were multiplexed and sequenced on HiSeq2000 platform (Illumina).
2014-01-01 | E-GEOD-52961 | biostudies-arrayexpress