Ruler Arrays Reveal Haploid Genomic Structural Variation
Ontology highlight
ABSTRACT:
ORGANISM(S): Saccharomyces cerevisiae
SUBMITTER: Alex Rolfe
PROVIDER: E-GEOD-23524 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:A ruler array combines novel sample preparation protocols, tiling genomic microarrays, and a new computational method to turn each probe on a microarray into a ruler that measures the physical distance between defined genomic sequences regardless of the intervening sequence. The ruler array protocol involves (1) genomic DNA purification (2) digestion with a restriction enzyme (3) ligation of a biotinylated adapter molecule to the cut sites (4) purification on streptavidin beads (5) polymerase extensions from a primer complementary to the adapter using labeled dNTPs and (6) hybridization to a tiling microarray
2010-09-16 | GSE23524 | GEO
Project description:Primary mediastinal B-cell lymphoma (PMBCL) is a distinct subtype of diffuse large B-cell lymphoma. PMBCL has been previously studied with a variety of genomic techniques resulting in frequent detection of chromosomal gains; however, chromosomal losses have been rarely reported. This finding contrasts many other types of lymphoma, in which deletions are common. We hypothesize that segmental losses do exist but may have escaped detection by methods used in the previous studies. Using array comparative genomic hybridization to a tiling-resolution microarray encompassing the entire human genome, PMBCL samples were analyzed for genomic copy number alterations. Both gains and losses of chromosomal material were detected throughout the genome. These DNA copy number alterations were confirmed by quantitative real-time PCR. Recurrent chromosomal losses include a novel event at 1p13.1-p13.2 present in 42% of cases analyzed. We conclude that losses are present in the PMBCL genome. Given the similar frequency of losses to that of segmental gains of DNA, they are likely to play an important role in the pathogenesis of PMBCL. Whole genome tiling path array CGH of 20 PMBCL tumor samples and one cell line was performed against male reference genomic DNA. Alterations were confirmed via DNA copy number quantitative real-time PCR
2007-08-15 | E-GEOD-7383 | biostudies-arrayexpress
Project description:Analysis of DNA from 89 oral lesions by whole genome tiling-path array comparative genomic hybridization. Keywords: array comparative genomic hybridization Genomic DNA isolated from 89 formalin-fixed paraffin-embedded oral dysplasias and tumors, then profiled by whole genome tiling-path array CGH to identify DNA copy alterations for each case.
2009-07-01 | E-GEOD-11275 | biostudies-arrayexpress
Project description:We would like to know how symbiotic molecules such as Nod Factors (NF) influence lateral root (LR) development in M. truncatula. We have preliminary evidence that this action is through early stages of root development. Auxin is the major phytohormone controlling LR development and we also have evidence that NF interfere with auxin for the control of LR development. This transcriptomic study aims at finding new molecular targets that would be responsive to auxin and NF treatment, even at a higher level by the combination of both auxin and NF. Such targets could be involved in the control or early development stages of LR that would be controlled both by auxin and NF treatment. - 2 day old M. truncatula (accession A17) plantlets grown on M medium were transferred for 2 days on M medium+ 10-5M NPA (1-N-Naphthylphthalamic acid, auxin transport inhibitor) then transferred for 10 h on M medium containing 10-6 M NAA (naphthalene-1-acetic acid, permeant auxin analog) or 10-7 M Nod factors (NF) or a combination of both (10-6 M NAA + 10-7 M NF). These are compared to mock treated (solvent only) plants. 12plex_med_2013_04 12 dye-swap - treated vs untreated comparison
2016-06-01 | E-GEOD-74099 | biostudies-arrayexpress
Project description:CGH profiles of prostate tumors on custom designed high resolution arrays tiling chromosome 5q21 A custom high-density Agilent 15k CGH array tiling 5q21 was designed to narrow down the region of deletion at 5q21 to a few genes that could be followed up with functional studies. 8 critical prostate tumors samples with the most focal regions of deletion were chosen to be profiled on the 5q21 tiling array.
2011-12-19 | E-GEOD-29228 | biostudies-arrayexpress
Project description:Using a methylated-DNA enrichment technique (MIRA) in combination with whole genome tiling arrays, we have characterized by MIRA-chip the entire B cell ‘methylome’ of an individual human at 100 base pair resolution. Methylated fragments in genomic DNA extracted from B cells were enriched with the MIRA assay and hybridized together with input genomic DNA to NimbleGen's whole genomc tiling array.
2008-12-31 | E-GEOD-13700 | biostudies-arrayexpress
Project description:Pharmaceuticals are pseudo persistent aquatic pollutants with unknown effects at environmentally relevant concentrations. Atlantic salmon (Salmo salar) were exposed to Acetaminophen: 54.77 ± 34.67; Atenolol: 11.08 ± 7.98 and Carbamazepine: 7.85 ± 0.13 µg•L-1 for 5 days. After Acetaminophen treatment, 19 proteins were differently expressed, of which 11 were significant with respect to the control group (eight up-regulated and three down-regulated). After Atenolol treatment, 7 differently expressed proteins were obtained in comparison with the control, of which 6 could be identified (four up-regulated and 2 down-regulated). Carbamazepine exposure resulted in 15 differently expressed proteins compared with the control, with 10 of them identified (seven up-regulated and three down-regulated). Out of these, 3 features were common between Acetaminophen and Carbamazepine and one between Carbamazepine and Atenolol. One feature was common across all treatments. Principal component analysis and heat map clustering showed a clear grouping of the variability due to the applied treatments. The obtained data suggest (1) that exposure to environmentally relevant concentrations of the pharmaceuticals alters the hepatic protein expression profile of the Atlantic salmon; and (2) the existence of treatment specific processes that may be useful for biomarker development.
2014-11-18 | PXD001354 | Pride
Project description:This SuperSeries is composed of the following subset Series: GSE29227: aCGH profiling of prostate tumors GSE29228: 5q21 tiling array on prostate tumors GSE33531: Gene expression profiling of prostate cells with CHD1 knockdown Refer to individual Series
2011-12-19 | E-GEOD-29229 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37°C. Finally, proteinase K (400 μg of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 53°C, 30 sec at 72°C, and 10 min at 72°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).
2015-12-15 | E-GEOD-64268 | biostudies-arrayexpress
Project description:To address co-transcriptional pre-mRNA processing events, Saccharomyces nascent RNA was isolated by chromatin fractionation and analyzed on a genome-wide high density tiling microarray. Co-transcriptional splicing efficiencies were derived by determination of intronic relative to exonic sequence concentrations. Nascent RNA, mRNA and genomic DNA were isolated from wild-type Saccharomyces cells and analyzed on a genome-wide high-density tiling microarry (Saccharomyces Tiling 1.0R Array, Affymetrix). At least 3 independent biological replicates were analyzed (nascent RNA (nRNA): 3 replicates, mRNA: 3 replicates, genomic DNA (gDNA): 4 replicates).
2010-11-26 | E-GEOD-24040 | biostudies-arrayexpress