Diverse roles and interactions of the SWI/SNF chromatin-remodeling complex revealed using global approaches
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Ghia Euskirchen
PROVIDER: E-GEOD-24398 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:A systems understanding of nuclear organization and events is critical for determining how cells divide, differentiate and respond to stimuli and for identifying the causes of diseases. Chromatin remodeling complexes such as SWI/SNF have been implicated in a wide variety of cellular processes including gene expression, nuclear organization, centromere function and chromosomal stability, and mutations in SWI/SNF components have been linked to several types of cancer. To better understand the biological processes in which chromatin remodeling proteins participate we globally mapped binding regions for several components of the SWI/SNF complex throughout the human genome using ChIP-Seq. SWI/SNF components were found to lie near regulatory elements integral to transcription (e.g. 5’ ends, RNA Polymerases II and III and enhancers) as well as regions critical for chromosome organization (e.g. CTCF, lamins and DNA replication origins). To further elucidate the association of SWI/SNF subunits with each other as well as with other nuclear proteins we also analyzed SWI/SNF immunoprecipitated complexes by mass spectrometry. Individual SWI/SNF factors are associated with their own family members as well as with cellular constituents such as nuclear matrix proteins, key transcription factors and centromere components implying a ubiquitous role in gene regulation and nuclear function. We find an overrepresentation of both SWI/SNF-associated regions and proteins in cell cycle and chromosome organization. Taken together the results from our ChIP and immunoprecipitation experiments suggest that SWI/SNF facilitates gene regulation and genome function more broadly and through a greater diversity of interactions than previously appreciated. ChIP-chip analysis of lamin A/C and lamin B in HeLa S3 cells
2011-01-10 | E-GEOD-24382 | biostudies-arrayexpress
Project description:A systems understanding of nuclear organization and events is critical for determining how cells divide, differentiate and respond to stimuli and for identifying the causes of diseases. Chromatin remodeling complexes such as SWI/SNF have been implicated in a wide variety of cellular processes including gene expression, nuclear organization, centromere function and chromosomal stability, and mutations in SWI/SNF components have been linked to several types of cancer. To better understand the biological processes in which chromatin remodeling proteins participate we globally mapped binding regions for several components of the SWI/SNF complex throughout the human genome using ChIP-Seq. SWI/SNF components were found to lie near regulatory elements integral to transcription (e.g. 5M-bM-^@M-^Y ends, RNA Polymerases II and III and enhancers) as well as regions critical for chromosome organization (e.g. CTCF, lamins and DNA replication origins). To further elucidate the association of SWI/SNF subunits with each other as well as with other nuclear proteins we also analyzed SWI/SNF immunoprecipitated complexes by mass spectrometry. Individual SWI/SNF factors are associated with their own family members as well as with cellular constituents such as nuclear matrix proteins, key transcription factors and centromere components implying a ubiquitous role in gene regulation and nuclear function. We find an overrepresentation of both SWI/SNF-associated regions and proteins in cell cycle and chromosome organization. Taken together the results from our ChIP and immunoprecipitation experiments suggest that SWI/SNF facilitates gene regulation and genome function more broadly and through a greater diversity of interactions than previously appreciated. ChIP-Seq analysis of the SWI/SNF subunits Ini1, Brg1, BAF155 and BAF170 in HeLa S3 cells
2011-01-10 | E-GEOD-24397 | biostudies-arrayexpress
Project description:We found that sonication of crosslinked chromatin produces breaks at non-random sites in DNA and can be used to map sites of high chromatin accessibility when combined with high-throughput tag sequencing using the GA II platform from Illumina. This technique, which we named Sono-Seq, can be a simple and broadly applicable method for mapping many open chromatin sites. Furthermore, these results give insights into reference sample types, such as Input DNA, normal IgG ChIP DNA, MNase-digested DNA, and naked DNA, that have been used in ChIP-chip and ChIP-Seq experiments. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf For this analysis, seven samples from HeLa S3 cells were included: RNA Polymerase II (GEO accession GSM320734), Sono-Seq/Input DNA (small fragments) that was size selected at 100-350 bp (GEO accession GSM320735), Sono-Seq/Input DNA (large fragments) size selected between 350-800 bp, naked DNA, normal mouse IgG, Sono-Seq/Input DNA stimulated with interferon-gamma (GEO accession GSM320737), and MNase-digested DNA. Two replicates were used for MNase-digested DNA and Sono-Seq/Input DNA (large fragments) whereas three replicates were used for all other samples. Naked DNA was used as a reference for scoring peaks.
2008-12-18 | E-GEOD-14022 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37°C. Finally, proteinase K (400 μg of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 53°C, 30 sec at 72°C, and 10 min at 72°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).
2015-12-15 | E-GEOD-64268 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series
2015-12-15 | E-GEOD-64270 | biostudies-arrayexpress
Project description:Genomewide mapping of D. melanogaster Tramtrack69 protein binding at 6-8hrs after egg laying. Two different rabbit antibodies were used to precipitate the Tramtrack69 protein isoform in 3 biological replicates. Additionally a rabbit preimmune-serum was used as a control for every precipitation. The enriched DNA was hybridized to high density Affymetrix GeneChip Drosophila Tiling 1.0R array.
2014-03-01 | E-MTAB-1287 | biostudies-arrayexpress
Project description:Genomewide mapping of D. melanogaster Lame duck protein binding at 6-8hrs after egg laying. Two different rabbit antibodies were used to precipitate the Lmd protein isoform in biological replicates. Additionally a rabbit preimmune-serum was used as a control. The enriched DNA was hybridized to high density Affymetrix GeneChip Drosophila Tiling 1.0R array.
2014-03-01 | E-MTAB-1283 | biostudies-arrayexpress
Project description:Genomewide mapping of D. melanogaster Snail protein binding during embryonic development at 2-4 hrs after egg-laying. Two independent repeats were assayed and preimmune-serum was used as a control. The enriched DNA was hybridized to high density Affymetrix GeneChip Drosophila Tiling 1.0R array
2014-01-10 | E-MTAB-1589 | biostudies-arrayexpress
Project description:Genomewide mapping of D. melanogaster Twist protein binding during embryonic development. Three consecutive timepoints (2-4, 4-6, 6-8 hrs after egg-laying) were assayed in two independent repeats each. Two different antibodies were used to precipitate the Twist protein. Additionally the respective preimmune-serum was used as a control for every precipitation. The enriched DNA was hybridized to high density Affymetrix GeneChip Drosophila Tiling 1.0R array.
2009-11-09 | E-TABM-651 | biostudies-arrayexpress
Project description:Genomewide mapping of D. melanogaster the muscle differentiation factor Mef2 protein binding during embryonic development. Five consecutive timepoints (2-4, 4-6, 6-8, 8-10, 10-12 hrs after egg-laying) were assayed in two independent repeats each. Two different antibodies were used to precipitate the Mef2 protein. Additionally the respective preimmune-serum was used as a control for every precipitation. The enriched DNA was hybridized to high density Affymetrix GeneChip Drosophila Tiling 1.0R array.
2009-11-09 | E-TABM-649 | biostudies-arrayexpress