Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SRSM1 synthetic decoy vs. scrambled transfections in MDA-MB-231 cells

ABSTRACT: Transcriptional profiling of MDA-MB-231 comparing the regulatory consequences of transfecting synthetic decoys carring sRSM1 motifs versus synthetic scrambled oligos

ORGANISM(S): Homo sapiens

PROVIDER: GSE35749 | GEO | 2012/02/28

SECONDARY ACCESSION(S): PRJNA155921

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

sRSM1 synthetic decoy vs. scrambled transfections in MDA-MB-231 cells

Project description:Transcriptional profiling of MDA-MB-231 comparing the regulatory consequences of transfecting synthetic decoys carring sRSM1 motifs versus synthetic scrambled oligos Two decoy/scrambled sets, each with two biological replicates

2012-02-28 | E-GEOD-35749 | biostudies-arrayexpress

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

Expression consequences of decoy vs scrambled oligonucleotides harboring AAAA[AGT]TT motif in MBA-MD-231 cell line

Project description:Dual-color transcriptional profiling of decoy-transfected cells, harboring AAAA[AGT]TT motif, versus scrambled-transfected cells as controls.

2009-11-04 | GSE18844 | GEO

Cell cycle motif decoy oligos

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

SCRaMbLEd synII

Project description:SCRaMbLEd synII

| PRJEB23542 | ENA

Synthetic circular miR-21 RNA decoys enhance tumor suppressor expression and impair tumor growth in mice (RNA-Seq)

Project description:Natural and synthetic circular RNAs effectively impair miRNA function. MiR-21-5p is a potent oncomiR presenting ~33% of all miRNAs across cancers, ~41% in lung adenocarcinoma (LUAD), and ~68% in LUAD-derived cells. We validate and identify five main tumor suppressors targeted by miR-21-5p by deletion of the MIR21 locus in LUAD cells. Synthetic, liposome-delivered circular miR-21-5p decoys enhance expression of these tumor suppressors and severely impair tumor cell vitality at low doses. Decoy efficacy is not increased by bulging of miR-21-5p targeting sites, but associated with substantial cellular decoy stability, indicated by a half-life of ~20h. The intraperitoneal application of nanoparticle-delivered miR-21-5p decoys significantly impairs tumor growth in mouse LUAD tumor models. Decoys are well tolerated and were enriched in lung tissue. However, despite low decoy abundance, tumor suppressor expression was only increased in subcutaneous tumors. These findings suggest nanoparticle-delivered circular miRNA decoys as potent therapeutics in cancer treatment.

2020-07-20 | GSE148684 | GEO

Synthetic circular miR-21 RNA decoys enhance tumor suppressor expression and impair tumor growth in mice (small RNA-Seq II)

2020-07-20 | GSE148735 | GEO

Synthetic circular miR-21 RNA decoys enhance tumor suppressor expression and impair tumor growth in mice (small RNA-Seq I)

2020-07-20 | GSE148734 | GEO

In-culture titration experiment for sRSE

Project description:In order to test the transcriptome-wide functionality of the identified sRSE instances, we performed an in vivo titration experiment in which synthetic RNA oligonucleotides harboring tandem sRSE1 repeats were used as intracellular decoys that would bind the putative trans factor, preventing it from targeting endogenous transcripts. Capped and poly-adenylated RNAs carrying tandem sRSE elements were transfected along with scrambled RNA molecules as control. 48 hours post-transfection, samples were subjected to transcriptome profiling to measure the regulatory consequences of the in-vivo titration of the sRSE-binding trans factor.

2014-07-24 | E-GEOD-49609 | biostudies-arrayexpress

Decoy vs Scrambled and siRNA vs Mock Transfected MBA-MD-231 Cell Line

Project description:This SuperSeries is composed of the SubSeries listed below.

2009-11-04 | GSE18874 | GEO