The AtGenExpress: hormone inhibitor or other chemical treatment of seedlings in Arabidopsis
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
SUBMITTER: Yukihisa Shimada
PROVIDER: E-GEOD-39385 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Arabidopsis seedlings of the wild-type or hormone mutants were treated with plant hormones. 72 samples were analyzed by Affymetrix GeneChip, ATH1
2012-07-16 | E-GEOD-39384 | biostudies-arrayexpress
Project description:Arabidopsis seedlings were grown for 1 week in Aradishes and then subjected to 5 min to 10 h of simulated microgravity using a 2D clinostat. RNA; proteins and metabolites were extracted and analyzed by RNA.seq and label free quantitative MS.
2022-12-31 | E-MTAB-4873 | biostudies-arrayexpress
Project description:In addition to its essential metabolic functions biotin is suggested a critical role in regulating gene expression. The first committed enzyme in biotin biosynthesis in Arabidopsis, 7-keto-8-aminopelargonic acid synthase is encoded by At5g04620 (BIO4). We isolated a novel T-DNA insertion mutant of BIO4 (bio4-1) showing a spontaneous cell death phenotype that could be rescued both by exogenous biotin and genetic complementation. The bio4-1 plants exhibited massive accumulation of hydrogen peroxide. The T-DNA insertion in the bio4-1 mutant contains a Methionine Sulfoxide Reductase B9 (AT4G21850) under a constitutive 35S CaMV promoter. To dissect the specific effects of biotin defiency on gene expression on a genome wide scale, we compared expression of wt Col-0 leaves with bio4-1 mutants and bio4-1 mutants complemented with D-biotin. Expression in leaves of Col-0 wt, bio4-1 mutants with a T-DNA insertion in the 5`-UTR of BIO4, and bio4-1 mutants complemented with watering with 200µM D-biotin.
2011-12-22 | E-GEOD-26631 | biostudies-arrayexpress
Project description:Two-week old bread wheat seedlings hydroponically grown Hoagland solution were transferred to potassium (K+)-free conditions for 8 d, their root and leaf proteome profiles were assessed using iTRAQ proteome method, and NCBInr database combined with the recently published bread wheat genome information were used to analyze the identified protein species. Over 4,000 unique proteins were identified, 818 K+-responsive protein species showed significant abundance regulation. The most majority of the identified K+-responsive protein species had exact gene loci, and showed no global but tissue- and chromosome- dependent genome distributions. The identified protein species were associated with diverse functions and exhibited organ-specific differences. Most of identified protein species associated with hormone synthesis were the enzymes involved in the synthesis of jasmonic acid (JA). Allene oxide synthase (AOS), a key JA synthesis-related enzyme, was significantly induced in both root and leaf organs of K+-deficient wheat seedlings, and its overexpression in rice enhanced the tolerance to low K+ or K+ deficiency, increased contents of K+ and JA and transcription levels of some K+-responsive genes. However, rice AOS T-DNA inserted mutant (osaos) exhibited more sensitivity to K+ deficiency. K+ deficiency significantly increased abundance of a high affinity K+ transporter (TaAHAK1), TaAHAK1 transgenic rice seedlings markedly alleviated sensitivity to K+ deficiency, and K+ deficiency also upregulated expression of homologous OsHAK1 gene in TaAOS transgenic rice plants. These results suggested an essential role of JA in K+ deficiency and gave molecular insight into the responses of plant to K+ deficiency.
2017-10-09 | PXD003570 | Pride
Project description:We used RNA-seq platform to determine role of a splicing factor RBM25 in regulation of gene expression and pre-mRNA splicing. We found that a loss-of-function allele of RBM25, rbm25-1, causes up- and down-regulation of a large number of genes. We further found that the rbm25-1 mutation results in defects in altenative splicing of transcripts of many genes including signal transduction components in stress responses. Examination of mRNA levels in bulked individual wild type and rbm25-1 mutant seedlings before and after ABA treatment.
2015-10-28 | E-GEOD-66737 | biostudies-arrayexpress
Project description:In this project we examined in-vitro effect of female sex hormones, estradiol and progesterone at average physiological concentration level on Chlamydia trachomatis gene expression level. Regulation of chlamydial gene expression by the female sex hormones oestradiol and progesterone was examined. A total of 16 chlamydial arrays were analysed with the 4 culture conditions (no hormone, E, P, E+P) x four replicates. Bacterial samples were grown in non-hormone treated culture were used as control
2010-09-16 | E-GEOD-24119 | biostudies-arrayexpress
Project description:Purpose: Brassica. juncea is vulnerable to abiotic stresses at specific stages in its life cycle. However, till date no attempts have been made to elucidate the genome-wide changes in the transcriptome of B. juncea subjected to either high temperature or drought stress. Hence, to gain global insights into genes, transcription factors and kinases regulated by these stresses and to provide basic information on coding transcripts that are associated with traits of agronomic importance, we utilized a combinatorial approach of next generation sequencing and de novo assembly to discover B. juncea transcriptome associated with high temperature and drought. Results: We constructed and sequenced three transcriptome libraries namely Brassica control (BC), Brassica high temperature stress (BHS) and Brassica drought stress (BDS) from control, high temperature treated and drought treated seedlings of Brassica juncea. More than 180 million purity filtered reads were generated which were processed through quality parameters and high quality reads were assembled de-novo using SOAPde-novo assembler. A total of 77750 unique transcripts were identified out of which 69,245 (89%) were annotated with high confidence. We established a subset of 19110 transcripts, which were differentially regulated by either high temperature and/or drought stress. Furthermore, 886 and 2834 transcripts that code for transcription factors and kinases, respectively, were also identified. Investigation of identified transcription factors revealed that 92 responded to high temperature, 72 exhibited alterations in expression during drought stress, and 60 were commonly associated with both the stresses. Similarly, 217, 259 and 193 kinases were responsive to high temperature, drought or both stresses, respectively. Maximum number of up-regulated transcription factors in high temperature and drought stress belonged to heat shock factors (HSFs) and dehydration responsive element-binding (DREB) families respectively. We also identified 239 metabolic pathways, which were perturbed during high temperature and drought treatments. Analysis of gene ontologies associated with differentially regulated genes forecasted their involvement in diverse biological processes. Conclusions: Our study provides first comprehensive discovery of B. juncea transcriptome under high temperature and drought stress conditions. Transcriptome resources generated in this study will enhance our understanding on the molecular mechanisms involved in defining the response of B. juncea against two important abiotic stresses. Furthermore this information would benefit designing of efficient crop improvement strategies for tolerance against conditions of high temperature regimes and water scarcity. Total three RNA-Seq libraries were prepared and sequenced independently [B. juncea control (BC), B. juncea high temperature stressed (BHS) and B. juncea drought stressed (BDS) on Illumina GAIIx sequencer].
2015-08-28 | E-GEOD-64242 | biostudies-arrayexpress
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:AtGenExpress: A multinational coordinated effort to uncover the transcriptome of the multicellular model organism Arabidopsis thaliana (Hybridisations done at NASC). The activity of genes and their encoded products can be regulated in several ways, but transcription is the primary level, since all other modes of regulation (RNA splicing, RNA and protein stability, etc.) are dependent on a gene being transcribed in the first place. The importance of transcriptional regulation has been underscored by the recent flood of global expression analyses, which have confirmed that transcriptional co-regulation of genes that act together is the norm, not the exception. Moreover, many studies suggest that evolutionary change is driven in large part by modifications of transcriptional programs. An essential first step toward deciphering the transcriptional code is to determine the expression pattern of all genes. With this goal in mind, an international effort to develop a gene expression atlas of Arabidopsis has been underway since fall 2003. This project, dubbed AtGenExpress, is funded by the DFG, and will provide the Arabidopsis community with access to a large set of Affymetrix microarray data. As part of this collaboration, we have generated expression data from 80 biologicaly different samples in triplicate. Series 1: Growth conditions: Sterilized seeds will be stratified at 4°C for 3 days, exposed to white light for 2 h to induce germination, and grown on MS agar plates (0.9 % agar) without sugar in total darkness for 4 days at 22°C. Seedlings will then be transferred to the light conditions described for each slide below for 1 h (to identify early induced genes) and 4 hrs (maximum expression of the first initial light response of most target genes), respectively. All light treatments will be done in parallel to minimize the number of dark controls. All samples will be done in triplicate and only with shoots. Experimenter name = Thomas Kretsch Experimenter institute = AtGenExpress Keywords: genetic_modification_design; organism_part_comparison_design; development_or_differentiation_design
2007-01-22 | GSE5617 | GEO
Project description:AtGenExpress: A multinational coordinated effort to uncover the transcriptome of the multicellular model organism Arabidopsis thaliana The activity of genes and their encoded products can be regulated in several ways, but transcription is the primary level, since all other modes of regulation (RNA splicing, RNA and protein stability, etc.) are dependent on a gene being transcribed in the first place. The importance of transcriptional regulation has been underscored by the recent flood of global expression analyses, which have confirmed that transcriptional co-regulation of genes that act together is the norm, not the exception. Moreover, many studies suggest that evolutionary change is driven in large part by modifications of transcriptional programs. An essential first step toward deciphering the transcriptional code is to determine the expression pattern of all genes. With this goal in mind, an international effort to develop a gene expression atlas of Arabidopsis has been underway since fall 2003. This project, dubbed AtGenExpress, is funded by the DFG, and will provide the Arabidopsis community with access to a large set of Affymetrix microarray data. As part of this collaboration, we have generated expression data from 80 biologicaly different samples in triplicate. Wild-type and ARR21C overexpressing seedlings were compared. Experimenter name = Takatoshi Kiba , Takeshi Mizuno Experimenter institute = AtGenExpress Keywords: ARR21C overexpression
2007-01-08 | GSE5699 | GEO