Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Circadian rhythms of sense and antisense transcription in a highly polyploid crop.

ABSTRACT: Sugarcane plants were grown in soil in a 12h light/ 12h dark photoperiod and 26oC for 3 months. Then, the plants were transferred to constant light conditions and 24 h later, leaves were harvested every 4 h for 48 h. Samples were collected from 24 h in constant light to 68 h in constant light and were labelled accordingly. Two biological replicates of each time point were made, with a dye swap with the reference. The reference used was a equimolar solution of all samples.

ORGANISM(S): Saccharum hybrid cultivar (mixed)

SUBMITTER: Milton Nishiyama Jr

PROVIDER: E-GEOD-42725 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Circadian rhythms of sense and antisense transcription in sugarcane, a highly polyploid crop.

Hotta Carlos Takeshi CT Nishiyama Milton Yutaka MY Souza Glaucia Mendes GM

PloS one 20130806 8

Commercial sugarcane (Saccharum hybrid) is a highly polyploid and aneuploid grass that stores large amounts of sucrose in its stem. We have measured circadian rhythms of sense and antisense transcription in a commercial cultivar (RB855453) using a custom oligoarray with 14,521 probes that hybridize to sense transcripts (SS) and 7,380 probes that hybridize to antisense transcripts (AS).We estimated that 32% of SS probes and 22% AS probes were rhythmic. This is a higher proportion of rhythmic prob ...[more]

PMID: 23936527

Similar Datasets

Project description:Five allotetraploid cotton species have adapted, through their transcriptional responses, to unique environments with distinct levels of inherent abiotic stresses. The transcriptional responses of leaf and root tissue in five allotetraploid cotton species (Gossypium hirsutum, G. barbadense, G. tomentosum, G. mustelinum, and G. darwinii) under salt stress have been investigated in this study using cotton long oligonucleotide microarrays. Physiological responses to salinity such as stomatal conductance, ion and osmoprotectant contents were also measured as indicators of imposed stress. Accessions from these five cotton species were hydroponically grown and gradually introduced to a NaCl treatment (15 dS m-1). The microarray results identified 2721 and 2460 differentially expressed genes under salt stress that were significant in leaf and root tissue, respectively. Many of these genes were classified under gene ontology (GO) categories that suggest abiotic stress. These allotetraploid cottons shared transcriptional responses to salinity, but also showed responses that were species-specific. No consistent differences in transcriptional response among the previously estimated phylogenetic branches were found. Stomatal conductance, ion accumulation, and betaine, trigonelline, and trehalose contents also indicated salt stress. This global assessment of transcriptional and physiological responses to salt stress of these cotton species may identify possible gene targets for crop improvement and evolutionary studies of cotton. Keywords: CEGC Cotton oligo salt stress The transcriptional responses of leaf and root tissue in five allotetraploid cotton species (Gossypium hirsutum, G. barbadense, G. tomentosum, G. mustelinum, and G. darwinii) under salt stress have been investigated in this study using cotton long oligonucleotide microarrays. Physiological responses to salinity such as stomatal conductance, ion and osmoprotectant contents were also measured as indicators of imposed stress. Accessions from these five cotton species were hydroponically grown and gradually introduced to a NaCl treatment (15 dS m-1).

Project description:Plant and virus materials, inoculation and symptom evaluation Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA). Microarray sample preparation and determination of viral titers Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).

Dataset Information

Circadian rhythms of sense and antisense transcription in a highly polyploid crop.

Publications

Circadian rhythms of sense and antisense transcription in sugarcane, a highly polyploid crop.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure