Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq data from six cell types for cell type phylogenetics

ABSTRACT: We sequenced mRNA from a total of 12 samples (6 different cell types, each with two biological replicates) to infer the relationship among those cell types Examination of mRNA levels in six different human cell types grown in culture with two biological replicates for each cell type

ORGANISM(S): Homo sapiens

SUBMITTER: Koryu Kin

PROVIDER: E-GEOD-63733 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Cell-type phylogenetics and the origin of endometrial stromal cells.

Kin Koryu K Nnamani Mauris C MC Lynch Vincent J VJ Michaelides Elias E Wagner Günter P GP

Cell reports 20150226 8

A challenge of genome annotation is the identification of genes performing specific biological functions. Here, we propose a phylogenetic approach that utilizes RNA-seq data to infer the historical relationships among cell types and to trace the pattern of gene-expression changes on the tree. The hypothesis is that gene-expression changes coincidental with the origin of a cell type will be important for the function of the derived cell type. We apply this approach to the endometrial stromal cell ...[more]

PMID: 25732829

Similar Datasets

Comparative transcriptomics of endometrial stromal fibroblasts

Project description:We sequenced mRNA of endometrial stromal fibroblasts from six mammalian species. Examination of mRNA levels in endometrial stromal fibroblasts from six mammalian species grown in culture with two biological replicates for each species

2016-08-01 | E-GEOD-67659 | biostudies-arrayexpress

tRNA-Derived Small Non-Coding RNAs in Response to Ischemia Inhibit Angiogenesis

Project description:Ischemic injuries will lead to necrotic tissue damage, and post-ischemia angiogenesis plays critical roles in blood flow restoration and tissue recovery. Recently, several types of small RNAs have been reported to be involved in this process. In this study, we first generated a rat brain ischemic model to investigate the involvement of new types of small RNAs in ischemia. We utilized deep sequencing and bioinformatics analyses to demonstrate that the level of small RNA fragments derived from tRNAs was strikingly up-regulated in the ischemic rat brain. Among these sequences, tRNAVal- and tRNAGly-derived small RNAs account for the most abundant segments. The up-regulation of tRNAVal- and tRNAGly-derived fragments was verified through northern blot and quantitative PCR analyses. The levels of these two fragments also increased in a mouse hindlimb ischemia model and cellular hypoxia model. Importantly, the overexpression of tRNAVal- and tRNAGly-derived fragments in endothelial cells inhibited cell proliferation, migration and tube formation. Our results indicate that tRNA-derived fragments are involved in tissue ischemia, and we demonstrate for the first time that tRNAVal- and tRNAGly-derived fragments inhibit angiogenesis by modulating the function of endothelial cells. Examine small RNAs involved in post-ischemia angiogenesis

2016-03-16 | E-GEOD-70473 | biostudies-arrayexpress

Nitrosative stress response in uropathogenic Escherichia coli (UPEC)

Project description:A strain of UPEC CFT073 lacking the three known NO detoxifiaction mechanisms, Hmp, FlRd and Nrf is used to study the global effect of NO on the pathogen Cultures were anaerobically grown in triplicates under two conditions: Without nitrosative stress or with nitrosative stress, induced by anaerobic growth on nitrate. RNA was extracted from the samples and following rRNA depletion, samples were analyzed by RNA-seq for genome wide transcriptional differences.

2015-06-15 | E-GEOD-69830 | biostudies-arrayexpress

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Genome-wide microRNA-expression analysis after p53 activation in hepatocellular carcinoma

Project description:In order to characterize the differentially expressed miRNAs after the p53 activation , small RNA-seq were used after the overexpression of p53 in HepG2 cells. Four samples of HepG2 cells were subjected to small RNA-seq in two biological replicates.The HepG2 cells were treated with 1Âµg/ml doxorubicin for 24 hours to induce the expression of p53. The experimental group(dox-treated HepG2ï¼HepG2_24h_rep1 and HepG2_24h_rep2) and control group(untreated HepG2: HepG2_0h_rep1 and HepG2_0h_rep2) were subjected to small RNA-seq to identify the p53-regulated miRNAs.

2015-11-03 | E-GEOD-74588 | biostudies-arrayexpress

Small RNAs expression of three hepatocellular carcinoma cell lines with different organ-tropism.

Project description:In this study we investigated the small RNAs expression profiling of three HCC cell lines with different organ-tropism.The parent cell line has low mestastasis ability in nude mice model. Subclone 1 has higher metastasis ability specific to lung, and subclone 2 has dual metastasis ability to lung and celiac lymph node. We aimed to explore differentially expressed small RNAs involved in process of HCC metastasis and organ-specific metastasis, and identify their biological functions. Examination of different small RNAs expression among the 3 cell types.

2014-06-30 | E-GEOD-39003 | biostudies-arrayexpress

Next Generation Sequencing Facilitates Quantitative Analysis of miRNAs in hepatic fibrosis and normal tissues.

Project description:Aim: Hepatic fibrosis is a major worldwide medical problem and can develop into liver cirrhosis and hepatocellular carcinoma(HCC). Until now, there are no effective drugs for liver ?brosis because the molecular mechanism of progression of liver fibrosis is not fully understood. MicroRNAs (miRNAs) are an important class of small non-coding functional RNAs that play a key role in many biological processes. The purpose of this study was to clarify how the aberrant expression of miRNAs participates in development of the liver fibrosis in rat liver fibrosis model. Methods: Fibrotic and paired normal liver tissues were collected and assesssed by deep sequencing technology. MiRNA pro?ling results were validated by quantitative real-time polymerase chain reaction (qRT-PCR) and bioinformatics was used to predict miRNA targets. Results: Nine deregulated miRNAs were induced in porcine serum (PS)-induced hepatic fibrosis versus normal liver. Further analysis revealed several signaling pathways (e.g., gap junction and neuroactive ligand-receptor interaction) may be associated with hepatic fibrogenesis. Conclusion: Several miRNAs are dysregulated in PS-induced hepatic fibrosis and seem to be closely associated with hepatic fibrogenesis. These results provide an experimental basis for understanding the mechanism of hepatic fibrosis. We sequenced two samples, including case and control. Each sample has two replicates.

2015-06-04 | E-GEOD-54028 | biostudies-arrayexpress

MiR-27a-3p in peripheral blood mononuclear cells as a potential marker for pancreatic cancer screening

Project description:Background & Aims: MicroRNAs have been shown to offer great potential in the diagnosis of cancer. We aimed to identify microRNAs in peripheral blood mononuclear cells (PBMCs) for diagnosing pancreatic cancer (PC). Methods: PBMCs microRNA expression was investigated in three independent cohorts including 352 participants (healthy, benign pancreatic/peripancreatic diseases (BPD), and PC). First, we used sequencing technology to identify differentially expressed microRNAs in 60 PBMCs samples for diagnosing PC. Quantitative reverse-transcriptase polymerase chain reaction assay was then applied to evaluate the expression of selected microRNAs. A logistic regression model was constructed using an independent cohort. Area under the receiver operating characteristic curve (AUC) was used to evaluate diagnostic accuracy. Results: We found that PBMCs miR-27a-3p could efficiently discriminate PC from BPD (AUC=0.840; 95% CI, 0.787 to 0.885; sensitivity=82.2%, specificity=76.7%). A panel composed of PBMCs miR-27a-3p and serum CA19-9 provided a high diagnostic accuracy in differentiating PC from BPD in the clinical setting (AUC=0.886; 95% CI, 0.837 to 0.923; sensitivity=85.3%, specificity=81.6%). The satisfactory diagnostic performance of the panel persisted regardless of disease status (AUCs for tumour-node-metastasis stages?,?, and ? were 0.881, 0.884, and 0.893, respectively). Conclusion: PBMCs miR-27a-3p could be a potential marker for PC screening. A panel composed of PBMCs miR-27a-3p and serum CA19-9 has considerable clinical value in diagnosing early-stage PC. Therefore, patients who would have otherwise missed the curative treatment window can benefit from optimal therapy. Examination of different MicroRNA profiles in 3 types of PBMCs samples

2012-05-03 | E-GEOD-37710 | biostudies-arrayexpress

Global transcriptional profiling of oleaginous yeast Rhodosporidium toruloides under nitrogen limitation.

Project description:Nitrogen limitation is a major regulator to initiate lipid overproduction in oleaginous fungi. To examine the influence of nitrogen starvation, chemiostat cultures of R. toruloides in defined media with abundant ammonium (MM) or minute ammonium (MM-N) were performed to obtain steady-state samples. Then Illumina's digital gene expression (DGE) technology was used for high-throughput transcriptome profiling of these samples. Two samples cultured in minimum media with abundant ammonium (MM) or minute ammonium (MM-N)

2012-06-29 | E-GEOD-39023 | biostudies-arrayexpress

Integrated detection of both 5-mC and 5-hmC by high-throughput tag sequencing technology highlights methylation reprogramming of bivalent genes during cellular differentiation [DGE]

Project description:5-methylcytosine (5-mC) can be oxidized to 5-hydroxymethylcytosine (5-hmC). Genome-wide profiling of 5-hmC thus far indicated 5-hmC may not only be an intermediate form of DNA demethylation but could also constitute an epigenetic mark per se. We describe a cost-effective and selective method to detect both the hydroxymethylation and methylation status of cytosines in more than 1.8 million MspI sites in the human genome. This method involves the selective glucosylation of 5-hmC residues, short-sequence tag generation and high-throughput sequencing. We tested this method by screening H9 human embryonic stem cells and their differentiated embroid body cells, and found that differential hydroxymethylation preferentially occur in bivalent genes during cellular differentiation. Especially, our results support hydroxymethylation can regulate key transcription regulators with bivalent marks through demethylation and affect cellular decision on choosing active or inactive state of these genes upon cellular differentiation. In order to explore the role of methylation and hyroxymethylation in regulating gene expression upon cellular differentiation to EBs, we examined the gene expression level in H9 human embryonic stem cells and their differentiated embroid body cells by Digital gene expression (DGE), respectively.

2012-12-20 | E-GEOD-40953 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data