Gene expression changes induced by BRD9876 in MM1S cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Shrikanta Chattopadhyay
PROVIDER: E-GEOD-64178 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We have used an agnostic approach to identify drug combinations by using combination high throughput screening (cHTS) technology and make the surprising discovery that adenosine A2A and beta-2 adrenergic receptor agonists are highly synergistic, selective and novel agents that enhance glucocorticoid activity in B-cell malignancies. We used the microarray study to understand the synergistic mechanism between dexamethasone and A2A receptor agonist or Beta-2 Adrenergic receptor agonist in a multiple myeloma cell line, MM1S. MM1S cells were treated with CGS-21680 or Salmeterol alone, or in combination with dexamethasone for six hours for RNA extraction and hybridization on Affymetrix microarrays.
2012-03-31 | E-GEOD-30644 | biostudies-arrayexpress
Project description:mRNA expression profile modified by stable transfection of microRNA mir-517a (MIR517A) in a human hepatocellular carcinoma cell line Huh-7 Keywords: Hepatocellular carcinoma, Expression array, microRNA microRNA mir-517a (MIR517A) was transfected to Huh-7 cells using GFP-expressing lentiviral vector. Infected cells were selected using flow cytometry and subjected to mRNA expression microarray experiment. The profiles were compared to controls cells infected with only GFP protein.
2011-02-17 | E-GEOD-20679 | biostudies-arrayexpress
Project description:Bromodomain inhibition comprises a promising therapeutic strategy in cancer, particularly for hematologic malignancies. To date, however, genomic biomarkers to direct clinical translation have been lacking. We conducted a cell-based screen of genetically-defined cancer cell lines using a prototypical inhibitor of BET bromodomains. Integration of genetic features with chemosensitivity data revealed a robust correlation between MYCN amplification and sensitivity to bromodomain inhibition. We characterized the mechanistic and translational significance of this finding in neuroblastoma, a childhood cancer with frequent amplification of MYCN. Genome-wide expression analysis demonstrated downregulation of the MYCN transcriptional program accompanied by suppression of MYCN transcription. Functionally, bromodomain-mediated inhibition of MYCN impaired growth and induced apoptosis in neuroblastoma. BRD4 knock-down phenocopied these effects, establishing BET bromodomains as transcriptional regulators of MYCN. BET inhibition conferred a significant survival advantage in three in vivo neuroblastoma models, providing a compelling rationale for developing BET bromodomain inhibitors in patients with neuroblastoma. Significance: Biomarkers of response to small-molecule inhibitors of BET bromodomains, a new compound class with promising anti-cancer activity, have been lacking. Here, we reveal MYCN amplification as a strong genetic predictor of sensitivity to BET bromodomain inhibitors, demonstrate a mechanistic rationale for this finding, and provide a translational framework for clinical trial development of BET bromodomain inhibitors for pediatric patients with MYCN-amplified neuroblastoma. JQ1 is a novel thieno-triazolo-1,4-diazepine, which displaces BET bromodomains from chromatin by competitively binding to the acetyl lysine recognition pocket. BE(2)-C and Kelly cells were treated in triplicate with 1 µM JQ1 or DMSO for 24 hours. RNA was extracted and a decrease in MYCN transcript was confirmed by real time RT-PCR as described above. The samples were profiled using the Affymetrix PrimeView Human Gene Expression Array (Affymetrix) at Beth Israel Deaconess Medical Center (Boston, MA, USA).
2013-02-25 | E-GEOD-43392 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series
2014-04-20 | E-GEOD-48555 | biostudies-arrayexpress
Project description:Children with Down syndrome (DS) have a 20-fold increased risk of developing B cell acute lymphoblastic leukemia (B-ALL). Polysomy 21 (i.e., extra copies of chr.21) is also the most frequent somatic aneuploidy among all B-ALLs. Additional B-ALLs harbor intrachromosomal amplifications of chr.21q22 (iAMP21). Yet, the mechanistic links between chr.21q22 triplication and B-ALL remain undefined. Here we show that germline triplication of only 31 genes orthologous to human chr.21q22 is sufficient to confer murine B cell self-renewal in vitro, B cell maturation defects in vivo, and B-ALL in concert with either BCR-ABL or CRLF2 with activated JAK2. Chr.21q22 triplication suppresses H3K27me3 in murine progenitor B cells and B-ALLs, and “bivalent” genes with both H3K27me3 and H3K4me3 at their promoters in wild-type progenitor B cells are preferentially overexpressed in triplicated cells. Strikingly, human B-ALLs with polysomy 21 are distinguished by their overexpression of genes known to be marked with H3K27me3 in multiple cell types. Finally, overexpression of HMGN1, a nucleosome remodeling protein encoded on chr.21q22, suppresses H3K27me3 and promotes both B cell proliferation in vitro and B-ALL in vivo. These data implicate HMGN1 overexpression and loss of H3K27me3 in progenitor B cell transformation and suggest strategies to target leukemias with polysomy 21. Gene expression analysis of 8 samples, 4 wild-type and 4 HMGN1 overexpressing transgenic B cells
2014-04-20 | E-GEOD-55629 | biostudies-arrayexpress
Project description:We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies.M-BM- In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk.M-BM- In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. M-BM- Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model.M-BM- Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. R940406 (R406, the active metabolite of fostamatinib) was supplied by Rigel Pharmaceuticals, Inc., South San Francisco, CA, and AstraZeneca Pharmaceuticals, Wilmington, DE, USA. R406 was resuspended in dimethyl sulfoxide (DMSO) (Sigma-Aldrich) and stored at M-bM-^HM-^R80M-BM-0C. . HL-60, U937 and KG-1 cell lines were purchased from the American Type Culture Collection. MOLM-14 cell lines were provided by Dr. Scott Amstrong (Dana-Farber Cancer Institute, Boston MA, USA.) All cell lines were maintained in RPMI 1640 (Cellgro) supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS, Sigma-Aldrich) at 37 M-BM-0C with 5% CO2. MOLM-14, U937, HL-60 and KG-1 cells were grown in 4mM R406 for 24 hours
2013-04-24 | E-GEOD-46302 | biostudies-arrayexpress
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:The transcriptomic changes induced in the human liver cell line HepG2 by 100M-BM-5M menadione, 200M-BM-5M TBH or 50M-BM-5M H2O2 after treatment for 0.5, 1, 2, 4, 6, 8 and 24h. The study investigated differential gene expression in HepG2 cell line mRNA following 0.5, 1, 2, 4, 6, 8 and 24h hours of exposure to 100M-BM-5M menadione, 200M-BM-5M TBH or 50M-BM-5M H2O2 and medium without compound. Three biological replicates per compound/solvent. In total 126 arrays.
2013-05-31 | E-GEOD-39291 | biostudies-arrayexpress
Project description:Mutations within the catalytic domain of the histone methyltransferase (HMT) EZH2 have been identified in subsets of Non-Hodgkin Lymphoma (NHL) patients. These genetic alterations are hypothesized to confer an oncogenic dependency on EZH2 enzymatic activity in these cancers. We previously reported the discovery of a potent, selective, S-adenosyl-methionine-competitive and orally bioavailable small molecule inhibitor of EZH2, EPZ-6438. EPZ-6438 selectively inhibits intracellular lysine 27 of histone H3 (H3K27) methylation in a concentration- and time-dependent manner in both EZH2 wild type and mutant lymphoma cells. Inhibition of H3K27 trimethylation (H3K27Me3) led to selective cell killing of human lymphoma cell lines bearing EZH2 catalytic domain point mutations. Treatment of xenograft-bearing mice with EPZ-6438 leads to dose-dependent tumor growth inhibition and eradication of genetically altered NHL with correlative diminution of H3K27Me3 levels in tumors and selected normal tissues. Mice dosed orally with EPZ-6438 for 28 days remained tumor free for up to 63 day after stopping compound treatment in two EZH2 mutant xenograft models. These data confirm the dependency of mutant NHL on EZH2 activity and portend the utility of EZH2-targeted drugs for the treatment of these genetically defined cancers. To identify potential biomarker and gain mechanistic insights in EPZ6438 treated lymphoma, lymphoma cell lines with or without EZH2 Y641 mutation were treated with EPZ6438 at Lowest Cytotoxic Concentration (LCC) and 10xLCC. Transcriptomes were profiled on Affemetrix U133 Plus2 chips. Differentially expressed genes and pathways upon compound treatment were anayzed. Lymphoma cell lines WSU-DLCL2, SU-DHL6, Pfeiffer, and Karpas422 were treated by EPZ6438 for 2 days, 4 days and 6 days. Treatment doses are LCC and 10xLCC of each cell lines. KARPAS_422, SUDHL6, and WSU_DLCL2 have the EZH2 Y641 mutation. PFEIFFER does not have the EZH2 Y641 mutation.
2014-02-19 | E-GEOD-49284 | biostudies-arrayexpress
Project description:Despite rapid progress in characterizing transcription factor-driven reprogramming of somatic cells to an induced pluripotent stem (iPS) cell state, many mechanistic questions still remain. To gain insight into the earliest events in the reprogramming process, we systematically analyzed the transcriptional and epigenetic changes that occur during early factor induction after discrete numbers of divisions. We observed rapid, genome-wide changes in the euchromatic histone modification, H3K4me2, at more than a thousand loci including large subsets of pluripotency or developmentally related gene promoters and enhancers. In contrast, patterns of the repressive H3K27me3 modification remained largely unchanged except for focused depletion specifically at positions where H3K4 methylation is gained. These chromatin regulatory events precede transcriptional changes within the corresponding loci. Our data provide evidence for an early, organized, and population-wide epigenetic response to ectopic reprogramming factors that clarify the temporal order through which somatic identity is reset during reprogramming. Gene expression was measured by Affymetric microarrays during the initial phase of the reprogramming of mouse embryonic fibroblasts.
2011-01-03 | E-GEOD-26096 | biostudies-arrayexpress