Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

MRNA cap methylation in pluripotency and differentiation

ABSTRACT: The mRNA cap recruits factors essential for transcript processing and translation initiation. We report that regulated mRNA cap methylation is a feature of embryonic stem cell (ESC) differentiation. Expression of the mRNA cap methyltransferase activating subunit, RAM, is elevated in ESCs resulting in high levels of mRNA cap methylation and expression of Oct4 and Sox2 and other pluripotency-associated factors. During neural differentiation, RAM is suppressed which is required for loss of Oct4 and Sox2 and correct expression of neural markers. Cells were treated with control or RAM siRNA and cytosolic RNA or polysome RNA (actively translated) was sequenced.

ORGANISM(S): Mus musculus

SUBMITTER: Victoria Cowling

PROVIDER: E-GEOD-81849 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

mRNA Cap Methylation in Pluripotency and Differentiation.

Grasso Laura L Suska Olga O Davidson Lindsay L Gonatopoulos-Pournatzis Thomas T Williamson Ritchie R Wasmus Lize L Wiedlich Simone S Peggie Mark M Stavridis Marios P MP Cowling Victoria H VH

Cell reports 20160721 5

The mRNA cap recruits factors essential for transcript processing and translation initiation. We report that regulated mRNA cap methylation is a feature of embryonic stem cell (ESC) differentiation. Expression of the mRNA cap methyltransferase activating subunit RAM is elevated in ESCs, resulting in high levels of mRNA cap methylation and expression of a cohort of pluripotency-associated genes. During neural differentiation, RAM is suppressed, resulting in repression of pluripotency-associated f ...[more]

PMID: 27452456

Similar Datasets

Requirement for the Mediator kinase module for activation of super-enhancer associated genes in colon cancer cells

Project description:RNA sequencing of HCT116 colon cancer cells following single and combined depletions of Mediator kinase module subunits CDK8, CDK19, MED12, MED13 and MED13L and the BET family protein BRD4. The results provide insight into the shared and specific functions of kinase module subunits and BRD4 in regulation of expression of transcriptional programs including genes associated with cancer acquired super-enhancers.

2018-04-02 | E-MTAB-5873 | biostudies-arrayexpress

Using ribosome profiling to investigate the effect of p53 on translation in cancer cells

Project description:p53 is deleted or dysfunctional, or develops these features during the course of disease, with a frequency of about 50% in human cancers. This is clinically important because this group of patients respond very poorly to treatment. Our approach to discovering novel biomarkers or targets for therapy for p53 deleted/dysfunctional disease is to find genes that are translationally regulated by p53. The aim of this experiment is to compare translational efficiencies in cancer cells that are p53 WT, p53-/-, or p53 R175H, in response to doxorubicin.

2021-02-22 | E-MTAB-8100 | biostudies-arrayexpress

SPECtre: a spectral coherence-based classifier of actively translated transcripts from ribosome profiling sequence data

Project description:Active protein translation can be assessed and measured using ribosome profiling sequencing strategies. Existing approaches make use of sequence fragment length or frame occupancy to differentiate between active translation and background noise, however they do not consider additional characteristics inherent to the technology which limits their overall accuracy. Here, we present an analytical tool that models the overall tri-nucleotide periodicity of ribosomal occupancy using a classifier based on spectral coherence. Our software, SPECtre, examines the relationship of normalized ribosome profiling read coverage over a rolling series of windows along a transcript against an idealized reference signal. A comparison of SPECtre against current methods on existing and new data shows a marked improvement in accuracy for detecting active translation and exhibits overall high sensitivity at a low false discovery rate. Classification of actively translated transcripts in ribosome profiling data derived from human neuroblastoma SH-SY5Y cells, and data previously published derived from mouse embryonic stem cells and zebrafish embryos.

2016-07-01 | E-GEOD-75947 | biostudies-arrayexpress

mitoRibo-seq and RNA-seq of parental and MRM2 knockout HEK 293T Flp-In T-REx cells

Project description:Methyltransferase MRM2 methylates the 2’-hydroxyl group of ribonucleotide U1369 of human 16S mt-rRNA. Mutations in MRM2 have been implicated in human mitochondrial-related disease. This study investigates the role of MRM2 in the biogenesis and function of human mitochondrial ribosomes. Absence of MRM2 leads to a severe defect in mitochondrial translation, with the mtLSU being trapped in immature assembly states.

2021-12-17 | E-MTAB-11292 | biostudies-arrayexpress

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

mRNA cap methyltransferase, RNMT-RAM, promotes RNA pol II transcription

Project description:mRNA cap addition occurs early during RNA pol II transcription, facilitating pre-mRNA processing and translation. We report that the mammalian mRNA cap methyltransferase, RNMT-RAM, promotes RNA pol II transcription, independently of mRNA capping and translation. In cells, sub-lethal suppression of RNMT-RAM reduces RNA pol II occupancy, net mRNA synthesis and pre-mRNA levels. Conversely, expression of RNMT-RAM increases transcription independently of cap methyltransferase activity. In isolated nuclei, recombinant RNMT-RAM stimulates transcriptional output; this requires the RAM RNA-binding domain. RNMT-RAM interacts with nascent transcripts along their entire length and with transcription associated factors including RNA pol II subunits, SPT4, SPT6 and PAFc. Suppression of RNMT-RAM inhibits transcriptional markers including histone H2B K120 ubiquitination, H3 K4 and K36 methylation, RNA pol II S5 and S2 phosphorylation and PAFc recruitment. These findings suggest that multiple interactions between RNMT-RAM, RNA pol II factors and RNA along the transcription unit stimulate transcription.

2018-05-01 | GSE87767 | GEO

Ribosome profiling of astrovirus-infected cells

Project description:Ribosome profiling (RiboSeq) is a high-throughput sequencing technique for globally mapping the positions of translating ribosomes on the transcriptome. We infected Caco2 cells with human astrovirus 1 (HAstV1). Cells were harvested at 12 hpi and either flash frozen with no pre-treatment (NT), or pre-treated with lactimidomycin for 30 minutes followed by flash freezing (LTM). These samples where then used for ribosome profiling.

2020-07-04 | E-MTAB-8045 | biostudies-arrayexpress

Disruption of KCC2 in parvalbumin-positive interneurons causes fatal epilepsy in mice

Project description:Since many years, we are interested in the regulation of the intraneuronal chloride concentration. We were the first group reporting a full knockout of the KCl-co-transporter KCC2, which dies immediately after birth due to respiratory failure. Notably, KCC2 loss-of-function mutations are associated with inherited febrile seizures, severe genetic generalized epilepsy and epilepsy of infancy with migrating focal seizures. Here, we used our floxed line to study the consequences of the disruption of KCC2 within parvalbumin-positive interneurons in mice. Remarkably, this leads to the disinhibition of PV-positive interneurons as evidenced by a decrease of E-S-Coupling and an increase in the sIPSC frequency. Nevertheless, these mice develop fatal epilepsy with progressive loss of parvalbumin-positive interneurons thus increasing network excitability.

2022-11-02 | E-MTAB-11147 | biostudies-arrayexpress

mRNA cap methylation in pluripotency and differentiation

Project description:The mRNA cap recruits factors essential for transcript processing and translation initiation. We report that regulated mRNA cap methylation is a feature of embryonic stem cell (ESC) differentiation. Expression of the mRNA cap methyltransferase activating subunit, RAM, is elevated in ESCs resulting in high levels of mRNA cap methylation and expression of Oct4 and Sox2 and other pluripotency-associated factors. During neural differentiation, RAM is suppressed which is required for loss of Oct4 and Sox2 and correct expression of neural markers.

2016-06-14 | GSE81849 | GEO

Ribosome profiling of UNR (CSDE1) KD

Project description:Investigation of the effects of UNR (CSDE1) knock-down on translation in Melanoma Cells using Ribosome Profiling

2016-11-07 | E-MTAB-3815 | biostudies-arrayexpress