Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

45 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq of MOLM-13 acute myeloid leukemia cell line treated with single and combination 5-Azacytidine and CB-5083

ABSTRACT: MOLM-13 acute myeloid leukemia cells were treated with 7 µM 5-Azacytidine (Cayman Chemical 11164), or 450 nM CB-5083 (Cayman Chemical 19311), or in combination, or 0.1% DMSO as control. Treatments were conducted for 48 hours.

INSTRUMENT(S): Illumina NovaSeq 6000

ORGANISM(S): Homo sapiens

SUBMITTER: Denise Ragusa

PROVIDER: E-MTAB-12848 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

RNA-seq of MOLM-13 acute myeloid leukemia cell line treated with FIDAS-5

Project description:MOLM-13 acute myeloid leukemia cells were treated with 3 µM FIDAS-5 methionine S-adenosyltransferase 2A (MAT2A) inhibitor or 0.1% DMSO as control for 48 hours

2023-04-22 | E-MTAB-12847 | biostudies-arrayexpress

Pyrethroid_resistant_strains_Aedes_aegypti

Project description:Transcriptome profiling of two pyrethroid resistant strains of Aedes aegypti compared to a susceptible strain. The two resistant strains are from Cuba and Cayman Island and the susceptible strain from New Orleans.

2012-11-16 | E-MTAB-868 | biostudies-arrayexpress

RNA sequencing of mouse embryonic stem cells (mES) and hemogenic gastruloids with MNX1 overexpression

Project description:Bulk RNA sequencing of 3-dimensional gastruloid differentiation system initiated from mouse embryonic stem (ES) cells and biased towards hemato-endothelial cell production with overexpression of MNX1 by lentiviral vector transduction

2022-10-10 | E-MTAB-12173 | biostudies-arrayexpress

Transcription profiling by array of human HL60 cells treated with eicosapantaenoic acid (EPA) to investigate the effect on the signalling pathways involved in growth arrest/apoptosis

Project description:We investigated the effect of EPA on the signalling pathways involved in growth arrest/apoptosis in HL60 cells. EPA inhibited cell proliferation in HL60 cells in a dose dependent manner. Gene expression profiling of HL60 cells treated with EPA was performed by Affymetrix GeneChip. System and key markers of relevant pathways were verified at protein level by western blotting.

2008-11-11 | E-MEXP-1389 | biostudies-arrayexpress

Data in support of Identification of potential autoantigens in anti-CCP-positive and anti-CCP-negative rheumatoid arthritis

Project description:The presence or absence of autoantibodies against citrullinated proteins (ACPAs) distinguishes two main groups of rheumatoid arthritis (RA) patients with different etiology, prognosis, disease severity, and, presumably, disease pathogenesis. The heterogeneous responses of RA patients to various biologics, even among ACPA-positive patients, emphasize the need for further stratification of the patients. We use high-density protein array technology to evaluate ACPA reactivity. Identification of the proteome recognized by ACPAs may be a step to stratify RA patients according to immune reactivity. Methods: Pooled plasma samples from 10 anti-CCP negative and 15 anti-CCP positive RA patients were assessed for ACPA-content using a modified protein microarray containing 1,631 different natively folded proteins citrullinated in situ by protein arginine deiminases (PAD) 2 and PAD4. Results: IgG antibodies from anti-CCP positive RA plasma showed high-intensity binding to 87 proteins citrullinated by PAD2 and 99 proteins citrullinated by PAD4 without binding significantly to the corresponding native proteins. Curiously, the binding of IgG antibodies in anti-CCP-negative plasma was also enhanced by PAD2- and PAD4-mediated citrullination for 29 and 26 proteins, respectively. For only 4 proteins, significantly more ACPA-binding occurred after citrullination with PAD2 compared to citrullination with PAD4, while the opposite was true for 1 protein.

2022-01-05 | PXD024955 | Pride

smallRNA-seq of Solanum lycopersicum bearing the sulfurea epiallele in nrpe1 versus WT

Project description:Plants bearing a sulfurea epiallele (TAB2sulf) were crossed with nrpe1 (largest polV subunit) mutants in Solanum Lycopersicum. 7 plants of a F3 progeny expected to be 100% TAB2sulf and segregating for the nrpe1 mutation were sequenced. 4 plants bear the nrpe1 mutation and 3 plants have NRPE1 WT alleles. The aim of the experiment was to compare sRNA accumulation between nrpe1 and WT F3 plants with particular interest on SlTAB2 (Solyc02g005200) which has been previously associated with paramutation in the sulfurea background. Both WT and nrpe1 F3 plants had methylation levels consistent with the TAB2sulf epiallele. nrpe1 and sulfurea parental controls are added in single replicates and a WT cv M82 plant is also sequenced as control. More replicates of WT and M82 are sequenced in a related experiment.

2021-07-02 | E-MTAB-10565 | biostudies-arrayexpress

Transciption profiling by array of human umbilical cord blood Natural Killer cells after overnight treatment with or without IL-15

Project description:Cord blood NK cells were cultured with or without IL-15 overnight and then RNA was isolated using an RNeasy Mini kit (Qiagen). Samples were processed using GeneChip Whole Transcript Sense Target Labeling assays using the Ambion WT Expression kit and Affymetrix GeneChip WT Terminal Labeling and Controls kit (Affymetrix). The resulting ssDNAs were hybridized to the Human Gene 2.0 ST Array (Affymetrix) and transcript levels compared between IL-15 treated and untreated using GeneSpring software.

2014-12-30 | E-MTAB-2847 | biostudies-arrayexpress

RNA-seq of adenoid cystic carcinoma (ACC) ACCX11 cells compared to normal salivary glands

Project description:PDX-derived ACCX11 adenoid cystic carcinoma cells were compared to normal salivary gland (NSG) controls.

2023-12-01 | E-MTAB-12978 | biostudies-arrayexpress

Bulk RNA-seq of trigeminal ganglia from C57BL/6 (wild-type) and Rag1KO mice with dry eye (extraorbital lacrimal gland excision model) versus sham-operated controls

Project description:Comparison of the effect of ocular surface desiccation and the lack of adaptive immunity (T and B cells) on gene expression in the trigeminal ganglia. Eight-week-old female mice of both strains were either operated on day 1 (either bilateral extraorbital lacrimal gland excision or sham surgery) and allowed to develop a dry eye state until day 10, when they were euthanized and the trigeminal ganglia were excised for RNA extraction. The two trigeminal ganglia of each mouse were pooled in one sample. There were 12 samples in total (2 x 2 design, 2 strains, 2 treatments).

2024-04-01 | E-MTAB-13945 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data