Chromatium okenii transcriptomics analysis
Ontology highlight
ABSTRACT:
INSTRUMENT(S): MinION
ORGANISM(S): Chromatium okenii
SUBMITTER: Francesco Di Nezio
PROVIDER: E-MTAB-13107 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:The purpose was to investigate transcript and splicing changes in U2OS cells following siRNA-mediated depletion of MDC1 and PLRG1 or treatment with the splicing inhibitor pladienolide B. Cells were treated with control siRNA as control condition. Nanopore sequencing of cDNA was performed after library preparation with ONT kits SQK-PCS109 and SQK-PBK004.
2023-01-11 | E-MTAB-12497 | biostudies-arrayexpress
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:Investigation of transcriptome changes in four human cell lines (BJ, BJ-5ta, U2OS and HeLa) after treatment for 24 hours with nicotinamide adenine dinucleotide (NAD+). Cells were untreated as the control condition. Nanopore sequencing of cDNA was performed after library preparation with the ONT SQK-PCB109 kit.
2023-09-20 | E-MTAB-13187 | biostudies-arrayexpress
Project description:Sequencing was performed to assess the ability of Nanopore direct cDNA and native RNA sequencing to characterise human transcriptomes. Total RNA was extracted from either HAP1 or HEK293 cells, and the polyA+ fraction isolated using oligodT dynabeads. Libraries were prepared using Oxford Nanopore Technologies (ONT) kits according to manufacturers instructions. Samples were then sequenced on ONT R9.4 flow cells to generate fast5 raw reads in the ONT MinKNOW software. Fast5 reads were then base-called using the ONT Albacore software to generate Fastq reads.
2019-03-14 | E-MTAB-7778 | biostudies-arrayexpress
Project description:In this study, based on Nanopore direct RNA-seq where native RNAs are sequenced directly as near full-length transcripts in the 3' to 5' direction, transcription units of the phytopathogen Dickeya dadantii 3937 were validated and transcriptional termination sites were determined. Briefly, D. dadantii cultures were grown in M63 medium supplemented with 0.2% glucose and 0.2% PGA, until the early exponential phase (A600nm = 0.2, condition 1), or the early stationary phase (A600nm = 1.8, condition 2). RNAs were extracted using a frozen acid-phenol method, as previously described (Hommais et al. 2008), and treated successively with Roche and Biolabs DNases. Two samples were prepared: 50 µg of RNAs from each condition were pulled into one sample (sample 1), whereas the other one contained 100 µg of RNAs from condition 2 (sample 2). Both samples were then supplied to Vertis Biotechnologie AG for Nanopore native RNA-seq: total RNA preparations were first examined by capillary electrophoresis. For sample 1, ribosomal RNA molecules were depleted using an in-house developed protocol (recovery rate = 84%), whereas no ribodepletion was performed for sample 2. 3' ends of RNA were then poly(A)-tailed using poly(A) polymerase, and the Direct RNA sequencing kit (SQK-RNA002) was used to prepare the library for 1D sequencing on the Oxford Nanopore sequencing device. The direct RNA libraries were sequenced on a MinION device (MIN-101B) using standard settings. Basecalling of the fast5 files was performed using Guppy (version 3.6.1) with the following settings: --flowcell FLO-MIN106 --kit SQK-RNA002 --cpu_threads_per_caller 12--compress_fastq --reverse_sequence true --trim_strategy rna. Reads smaller than 50 nt were removed. 466 393 and 556 850 reads were generated for sample 1 and 2, respectively.
2022-01-01 | E-MTAB-10482 | biostudies-arrayexpress
Project description:Nonsense-mediated mRNA decay (NMD) is a eukaryotic, translation-dependent degradation pathway that targets mRNAs with premature termination codons and also regulates the expression of some mRNAs that encode full-length proteins. Although many genes express NMD-sensitive transcripts, identifying them based on short-read sequencing data remains a challenge. To identify and analyze endogenous targets of NMD, we applied cDNA Nanopore sequencing and short-read sequencing to human cells with varying expression levels of NMD factors. Our approach detects full-length NMD substrates that are highly unstable and increase in levels or even only appear when NMD is inhibited. Among the many new NMD-targeted isoforms that our analysis identified, most derive from alternative exon usage. The isoform-aware analysis revealed many genes with significant changes in splicing but no significant changes in overall expression levels upon NMD knockdown. NMD-sensitive mRNAs have more exons in the 3΄UTR and for mRNAs with a termination codon in the last exon. The length of the 3΄UTR per se does not correlate with NMD sensitivity. Analysis of splicing signals reveals isoforms where NMD has been co-opted in the regulation of gene expression, but a main function is most likely to rid the transcriptome of isoforms resulting from spurious splicing events. Long-read sequencing enabled the identification of many novel NMD-sensitive mRNAs and revealed both known and unexpected features concerning their biogenesis and their biological role. Our data provide a highly valuable resource of human NMD transcript targets for future genomic and transcriptomic applications.
2021-07-20 | E-MTAB-10452 | biostudies-arrayexpress
Project description:Localisation of CpG methylation in yeast expressing murine DNMTS Genomic DNA was purified from a control strain and a strain expressing murine DNMTs
2020-09-30 | E-MTAB-9356 | biostudies-arrayexpress
Project description:Nanopore RNA sequencing of polyA+ chromatin associated RNA of Naive CD4+ T cells to identify novel chromatin associated RNAs containing TEs.
2021-10-20 | E-MTAB-10797 | biostudies-arrayexpress
Project description:In this experiment we wanted to see how the binding behavior of the S. Cerevisiae transcription factor Leu3, on of the main regulators of leucine biosynthesis, is affected by different availability of the branched chain amino acids. For this we grow the cells in shake flask under glucose limitation and treated them 2 hours before sampling. The cells were then cross-linked with formaldehyde and ChIP-seq was performed using the Oxford Nanopore MinIon.
2020-07-01 | E-MTAB-8820 | biostudies-arrayexpress
Project description:The naked mole-rat (NMR; Heterocephalus glaber) has recently gained considerable attention in the scientific community for its unique potential to unveil novel insights in the fields of medicine, biochemistry, and evolution. NMRs exhibit unique adaptations that include protracted fertility, cancer resistance, eusociality, and anoxia. This suite of adaptations is not found in other rodent species, suggesting that interrogating conserved and accelerated regions in the NMR genome will find regions of the NMR genome fundamental to their unique adaptations. However, the current NMR genome assembly has limits that make studying structural variations, heterozygosity, and non-coding adaptations challenging. We present a complete diploid naked-mole rat genome assembly by integrating long-read and 10X-linked read genome sequencing of a male NMR and its parents, and Hi-C sequencing in the NMR hypothalamus (N=2). Reads were identified as maternal, paternal or ambiguous (TrioCanu). We then polished genomes with Flye, Racon and Medaka. Assemblies were then scaffolded using the following tools in order: Scaff10X, Salsa2, 3d-DNA, Minimap2-alignment between assemblies, and the Juicebox Assembly Tools. We then subjected the assemblies to another round of polishing, including short-read polishing with Freebayes. We assembled the NMR mitochondrial genome with mitoVGP. Y chromosome contigs were identified by aligning male and female 10X linked reads to the paternal genome and finding male-biased contigs not present in the maternal genome. Contigs were assembled with publicly available male NMR Fibroblast Hi-C-seq data (SRR820318). Both assemblies have their sex chromosome haplotypes merged so that both assemblies have a high-quality X and Y chromosome. Finally, assemblies were evaluated with Quast, BUSCO, and Merqury, which all reported the base-pair quality and contiguity of both assemblies as high-quality. The assembly will next be annotated by Ensembl using public RNA-seq data from multiple tissues (SRP061363). Together, this assembly will provide a high-quality resource to the NMR and comparative genomics communities.
2022-06-27 | E-MTAB-11830 | biostudies-arrayexpress