Dataset Information

Mutations in the ectodomain of newcastle disease virus fusion protein confer a hemagglutinin-neuraminidase-independent phenotype.

ABSTRACT: The entry of enveloped viruses into host cells is preceded by membrane fusion, which in paramyxoviruses is triggered by the fusion (F) protein. Refolding of the F protein from a metastable conformation to a highly stable postfusion form is critical for the promotion of fusion, although the mechanism is still not well understood. Here we examined the effects of mutations of individual residues of the F protein of Newcastle disease virus, located at critical regions of the protein, such as the C terminus of the N-terminal heptad repeat (HRA) and the N terminus of the C-terminal heptad repeat (HRB). Seven of the mutants were expressed at the cell surface, showing differences in antibody reactivity in comparison with the F wild type. The N211A, L461A, I463A, and I463F mutants showed a hyperfusogenic phenotype both in syncytium and in dye transfer assays. The four mutants promoted fusion more efficiently at lower temperatures than the wild type did, meaning they probably had lower energy requirements for activation. Moreover, the N211A, I463A, and I463F mutants exhibited hemagglutinin-neuraminidase (HN)-independent activity when influenza virus hemagglutinin (HA) was coexpressed as an attachment protein. The data are discussed in terms of alterations of the refolding pathway and/or the stability of the prefusion and fusion conformations.

SUBMITTER: Ayllon J

PROVIDER: S-EPMC2798362 | biostudies-literature | 2010 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Mutations in the ectodomain of newcastle disease virus fusion protein confer a hemagglutinin-neuraminidase-independent phenotype.

Ayllón Juan J Villar Enrique E Muñoz-Barroso Isabel I

Journal of virology 20091111 2

The entry of enveloped viruses into host cells is preceded by membrane fusion, which in paramyxoviruses is triggered by the fusion (F) protein. Refolding of the F protein from a metastable conformation to a highly stable postfusion form is critical for the promotion of fusion, although the mechanism is still not well understood. Here we examined the effects of mutations of individual residues of the F protein of Newcastle disease virus, located at critical regions of the protein, such as the C t ...[more]

PMID: 19906934

Similar Datasets

Project description:Influenza A virus (IAV), a major cause of human morbidity and mortality, continuously evolves in response to selective pressures. Stem-directed, broadly neutralizing antibodies (sBnAbs) targeting the influenza virus hemagglutinin (HA) are a promising therapeutic strategy, but neutralization escape mutants can develop. We used an integrated approach combining viral passaging, deep sequencing, and protein structural analyses to define escape mutations and mechanisms of neutralization escape in vitro for the F10 sBnAb. IAV was propagated with escalating concentrations of F10 over serial passages in cultured cells to select for escape mutations. Viral sequence analysis revealed three mutations in HA and one in neuraminidase (NA). Introduction of these specific mutations into IAV through reverse genetics confirmed their roles in resistance to F10. Structural analyses revealed that the selected HA mutations (S123G, N460S, and N203V) are away from the F10 epitope but may indirectly impact influenza virus receptor binding, endosomal fusion, or budding. The NA mutation E329K, which was previously identified to be associated with antibody escape, affects the active site of NA, highlighting the importance of the balance between HA and NA function for viral survival. Thus, whole-genome population sequencing enables the identification of viral resistance mutations responding to antibody-induced selective pressure.IMPORTANCE Influenza A virus is a public health threat for which currently available vaccines are not always effective. Broadly neutralizing antibodies that bind to the highly conserved stem region of the influenza virus hemagglutinin (HA) can neutralize many influenza virus strains. To understand how influenza virus can become resistant or escape such antibodies, we propagated influenza A virus in vitro with escalating concentrations of antibody and analyzed viral populations by whole-genome sequencing. We identified HA mutations near and distal to the antibody binding epitope that conferred resistance to antibody neutralization. Additionally, we identified a neuraminidase (NA) mutation that allowed the virus to grow in the presence of high concentrations of the antibody. Virus carrying dual mutations in HA and NA also grew under high antibody concentrations. We show that NA mutations mediate the escape of neutralization by antibodies against HA, highlighting the importance of a balance between HA and NA for optimal virus function.

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Dataset Information

Mutations in the ectodomain of newcastle disease virus fusion protein confer a hemagglutinin-neuraminidase-independent phenotype.

Publications

Mutations in the ectodomain of newcastle disease virus fusion protein confer a hemagglutinin-neuraminidase-independent phenotype.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets