Dataset Information

Identification of a potential neutralizing linear epitope of hemagglutinin-neuraminidase in Newcastle disease virus.

ABSTRACT:

Background

The hemagglutinin-neuraminidase (HN) protein of Newcastle disease virus (NDV) is a major antigen that can induce protective antibodies in poultry. However, its antigenic epitopes have not been fully elucidated. Therefore, defining the linear epitopes of HN, especially neutralizing epitopes, will be useful for revealing its antigenic characterization.

Methods

In this study, we analyzed B-cell immunodominant epitopes (IDEs) of the HN protein from the vaccine strain LaSota using pepscan technology with LaSota-specific chicken hyperimmune antisera. We constructed IDEs-RFP plasmids and prepared anti-IDEs peptide mouse sera to identify IDEs through immunological tests. At last, the different diluted anti-IDE antisera were used in BHK-21 cells to perform the neutralization test.

Results

Five IDEs of the HN were screened and further verified by indirect immunofluorescence assays, dot blots and Western blots with NDV- and IDEs-specific antisera. All five IDEs showed good immunogenicity. IDE5 (328-342 aa) could recognize only class II NDV but did not react with the class I strain. Most of the IDEs are highly conserved among the different strains. A neutralization test in vitro showed that the peptide-specific mouse antisera of IDE4 (242-256 aa) and HN341-355, a reported neutralizing linear epitope, could partially neutralize avirulent LaSota as well as virulent strains at similar levels, suggesting that IDE4 might be a potential neutralizing linear epitope.

Conclusion

The HN protein is a major protective antigen of NDV that can induce neutralizing antibodies in animals. We identified five IDEs of the HN using a pepscan approach with NDV-specific chicken hyperimmune antisera. The five IDEs could elicit specific antibodies in mice. IDE4 (242-256 aa) was identified as a novel potential neutralizing linear epitope. These results will help elucidate the antigenic epitopes of the HN and facilitate the development of NDV vaccines.

SUBMITTER: Jin Z

PROVIDER: S-EPMC7789432 | biostudies-literature | 2021 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Identification of a potential neutralizing linear epitope of hemagglutinin-neuraminidase in Newcastle disease virus.

Jin Zhongyuan Z Wei Qiaolin Q Bi Youkun Y Li Yongshan Y Huo Na N Mou Sujing S Wang Wenbin W Liu Haijin H Yang Zengqi Z Chen Hongjun H Xiao Sa S

Virology journal 20210106 1

<h4>Background</h4>The hemagglutinin-neuraminidase (HN) protein of Newcastle disease virus (NDV) is a major antigen that can induce protective antibodies in poultry. However, its antigenic epitopes have not been fully elucidated. Therefore, defining the linear epitopes of HN, especially neutralizing epitopes, will be useful for revealing its antigenic characterization.<h4>Methods</h4>In this study, we analyzed B-cell immunodominant epitopes (IDEs) of the HN protein from the vaccine strain LaSota ...[more]

PMID: 33407693

Similar Datasets

Project description:BackgroundNewcastle disease virus (NDV) belongs to the genus Avaluvirus and Paramyxoviridae family, and it can cause acute, highly contagious Newcastle disease in poultry. The two proteins, haemagglutinin neuraminidase (HN) and Fusion (F), are the main virulence factor of the virus and play an essential role in immunogenicity against the virus. In most paramyxoviruses, the F protein requires HN protein to fuse the membrane, and HN proteins substantially enhance the viruses' fusion activity.ResultsThe present study describes the successful cloning and expression of HN protein from NDV in Bacillus subtilis WB800 using the modified shuttle vector pHT43. HN coding sequence was cloned into the pGet II vector. It was then subcloned into the PHT43 shuttle vector and transferred to Escherichia coli for replication. The recombinant plasmid was extracted from E. coli and used to transform B. subtilis by electroporation. After induction of recombinant B. subtilis by IPTG, total cell protein and the protein secreted into the media were analysed through a time course using SDS-PAGE. The expressed HN protein was purified using cation exchange chromatography followed by metal affinity chromatography, using the 6× His epitope introduced at the carboxyl terminus of the recombinant protein. The accuracy of the PHT43-HN construct was confirmed by sequencing and enzymatic digestion. SDS-PAGE results showed that the recombinant HN protein was successfully expressed and secreted into the medium. Moreover, the purified HN protein showed neuraminidase activity with characteristics similar to the indigenous HN NDV protein. B. subtilis is a free endotoxin host that could be a favourite prokaryotic platform for producing the recombinant HN protein.ConclusionThe establishment of this expression and purification system has allowed us to explore further the biochemical characteristics of HN protein and obtain material that could be suitable for a new production of NDV candidate vaccine with high immunogenicity.

Project description:The antiviral mechanism of sulfated polysaccharides is supposed to prevent virus entry, which is mediated by the interactions of anionic charges on sulfated polysaccharides with positively charged domains of viral envelope glycoproteins, leading to shielding of the functional domain involved in virus attachment to cell surface receptors. But, few direct evidences were reported. In the previous study, we found that sulfated Chuanmingshen violaceum polysaccharides (sCVPS) possessed remarkable inhibitory effect against Newcastle disease virus (NDV) through inhibition of NDV attachment to host cells. Whether sCVPS bound to hemagglutinin-neuraminidase (HN) leading to inhibition of NDV attachment needs to be further clarified. The present study conducted site-directed mutagenesis of possible positively charged residues of HN, and found that mutants R197G, H199G, R363G, and R523G could significantly decrease the inhibitory effects of sCVPS on receptor binding ability through hemadsorption assay, especially R363G which suggested that binding to R363 is more effective to shield the sialic acid binding sites. Dual mutants (R363G/R197G, R363G/H199G and R363G/R523G) induced more decreased inhibitory effect of sCVPS than single mutants. The immunofluorescence study using FITC-labeled sCVPS found that the fluorescence intensity of mutants R363G and R363G/H199G were significantly decreased. The binding kinetics of sCVPS to HN measured by surface plasmon resonance indicated that sCVPS had a higher binding affinity for wild-type HN than mutants R363G and R363G/H199G. Plaque reduction study was performed using recombinant NDV with mutant HNR363G and HNR363G/H199G, which showed significantly decreased inhibitory effects of sCVPS against mutant NDV adsorption to BHK-21 cells. These results suggested that the residues R197, H199, R363, and R523 were the binding sites for sCVPS, especially R363 act as the main interaction site. The present study provided direct evidence for the theory that antiviral mechanism of sulfated polysaccharides attributed to anionic groups binding to the positively charged residues of viral proteins which led to the shielding of receptor binding sites.

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Dataset Information

Identification of a potential neutralizing linear epitope of hemagglutinin-neuraminidase in Newcastle disease virus.

Background

Methods

Results

Conclusion

Publications

Identification of a potential neutralizing linear epitope of hemagglutinin-neuraminidase in Newcastle disease virus.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets