Variation of a newcastle disease virus hemagglutinin-neuraminidase linear epitope.
Ontology highlight
ABSTRACT:
SUBMITTER: Cho SH
PROVIDER: S-EPMC2292945 | biostudies-literature | 2008 Apr
REPOSITORIES: biostudies-literature
Publications
Variation of a newcastle disease virus hemagglutinin-neuraminidase linear epitope.
Cho Sun-Hee SH Kwon Hyuk-Joon HJ Kim Tae-Eun TE Kim Jae-Hong JH Yoo Han-Sang HS Kim Sun-Joong SJ
Journal of clinical microbiology 20080213 4
Fifty-six Newcastle disease virus strains collected from 2000 to 2006 could be grouped into subgenotype VIId. However, they displayed cumulative mutations in and around the linear epitope of hemagglutinin-neuraminidase (residues 345 to 353) with time. The antigenicities of the variants that became predominant in Korea differ from each other and from the wild type. ...[more]
Similar Datasets
Project description:BackgroundThe hemagglutinin-neuraminidase (HN) protein of Newcastle disease virus (NDV) is a major antigen that can induce protective antibodies in poultry. However, its antigenic epitopes have not been fully elucidated. Therefore, defining the linear epitopes of HN, especially neutralizing epitopes, will be useful for revealing its antigenic characterization.MethodsIn this study, we analyzed B-cell immunodominant epitopes (IDEs) of the HN protein from the vaccine strain LaSota using pepscan technology with LaSota-specific chicken hyperimmune antisera. We constructed IDEs-RFP plasmids and prepared anti-IDEs peptide mouse sera to identify IDEs through immunological tests. At last, the different diluted anti-IDE antisera were used in BHK-21 cells to perform the neutralization test.ResultsFive IDEs of the HN were screened and further verified by indirect immunofluorescence assays, dot blots and Western blots with NDV- and IDEs-specific antisera. All five IDEs showed good immunogenicity. IDE5 (328-342 aa) could recognize only class II NDV but did not react with the class I strain. Most of the IDEs are highly conserved among the different strains. A neutralization test in vitro showed that the peptide-specific mouse antisera of IDE4 (242-256 aa) and HN341-355, a reported neutralizing linear epitope, could partially neutralize avirulent LaSota as well as virulent strains at similar levels, suggesting that IDE4 might be a potential neutralizing linear epitope.ConclusionThe HN protein is a major protective antigen of NDV that can induce neutralizing antibodies in animals. We identified five IDEs of the HN using a pepscan approach with NDV-specific chicken hyperimmune antisera. The five IDEs could elicit specific antibodies in mice. IDE4 (242-256 aa) was identified as a novel potential neutralizing linear epitope. These results will help elucidate the antigenic epitopes of the HN and facilitate the development of NDV vaccines.
| S-EPMC7789432 | biostudies-literature
Project description:The present study describes the development of DNA vaccines using the hemagglutinin-neuraminidase (HN) and fusion (F) genes from AF2240 Newcastle disease virus strain, namely pIRES/HN, pIRES/F and pIRES-F/HN. Transient expression analysis of the constructs in Vero cells revealed the successful expression of gene inserts in vitro. Moreover, in vivo experiments showed that single vaccination with the constructed plasmid DNA (pDNA) followed by a boost with inactivated vaccine induced a significant difference in enzyme-linked immunosorbent assay antibody levels (p < 0.05) elicited by either pIRES/F, pIRES/F+ pIRES/HN or pIRES-F/HN at one week after the booster in specific pathogen free chickens when compared with the inactivated vaccine alone. Taken together, these results indicated that recombinant pDNA could be used to increase the efficacy of the inactivated vaccine immunization procedure.
| S-EPMC4808640 | biostudies-literature
Project description:Paramyxoviruses are the leading cause of respiratory disease in children. Several paramyxoviruses possess a surface glycoprotein, the hemagglutinin-neuraminidase (HN), that is involved in attachment to sialic acid receptors, promotion of fusion, and removal of sialic acid from infected cells and progeny virions. Previously we showed that Newcastle disease virus (NDV) HN contained a pliable sialic acid recognition site that could take two states, a binding state and a catalytic state. Here we present evidence for a second sialic acid binding site at the dimer interface of HN and present a model for its involvement in cell fusion. Three different crystal forms of NDV HN now reveal identical tetrameric arrangements of HN monomers, perhaps indicative of the tetramer association found on the viral surface.
| S-EPMC371092 | biostudies-literature
Project description:The entry of enveloped viruses into host cells is preceded by membrane fusion, which in paramyxoviruses is triggered by the fusion (F) protein. Refolding of the F protein from a metastable conformation to a highly stable postfusion form is critical for the promotion of fusion, although the mechanism is still not well understood. Here we examined the effects of mutations of individual residues of the F protein of Newcastle disease virus, located at critical regions of the protein, such as the C terminus of the N-terminal heptad repeat (HRA) and the N terminus of the C-terminal heptad repeat (HRB). Seven of the mutants were expressed at the cell surface, showing differences in antibody reactivity in comparison with the F wild type. The N211A, L461A, I463A, and I463F mutants showed a hyperfusogenic phenotype both in syncytium and in dye transfer assays. The four mutants promoted fusion more efficiently at lower temperatures than the wild type did, meaning they probably had lower energy requirements for activation. Moreover, the N211A, I463A, and I463F mutants exhibited hemagglutinin-neuraminidase (HN)-independent activity when influenza virus hemagglutinin (HA) was coexpressed as an attachment protein. The data are discussed in terms of alterations of the refolding pathway and/or the stability of the prefusion and fusion conformations.
| S-EPMC2798362 | biostudies-literature
Project description:The paramyxovirus hemagglutinin-neuraminidase (HN) protein plays multiple roles in viral entry and egress, including binding to sialic acid receptors, activating the fusion (F) protein to activate membrane fusion and viral entry, and cleaving sialic acid from carbohydrate chains. HN is an oligomeric integral membrane protein consisting of an N-terminal transmembrane domain, a stalk region, and an enzymatically active neuraminidase (NA) domain. Structures of the HN NA domains have been solved previously; however, the structure of the stalk region has remained elusive. The stalk region contains specificity determinants for F interactions and activation, underlying the requirement for homotypic F and HN interactions in viral entry. Mutations of the Newcastle disease virus HN stalk region have been shown to affect both F activation and NA activities, but a structural basis for understanding these dual affects on HN functions has been lacking. Here, we report the structure of the Newcastle disease virus HN ectodomain, revealing dimers of NA domain dimers flanking the N-terminal stalk domain. The stalk forms a parallel tetrameric coiled-coil bundle (4HB) that allows classification of extensive mutational data, providing insight into the functional roles of the stalk region. Mutations that affect both F activation and NA activities map predominantly to the 4HB hydrophobic core, whereas mutations that affect only F-protein activation map primarily to the 4HB surface. Two of four NA domains interact with the 4HB stalk, and residues at this interface in both the stalk and NA domain have been implicated in HN function.
| S-EPMC3169104 | biostudies-literature
Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.
| S-EPMC5993761 | biostudies-literature
Project description:Newcastle disease is a highly contagious viral infection affecting many species of birds that can spread fast between poultry houses and cause a heavy economic burden on the poultry industry all around the world. Fusion and hemagglutinin-neuraminidase (HN) protein are important in the pathogenesis of the Newcastle disease virus (NDV). The HN protein is a critical viral protein with multiple functions and plays a key role in the formation of the virulence of NDV. Head of HN protein is responsible for receptor binding, neuraminidase activity. This study aimed to investigate the sequence homology of hemagglutinin-neuraminidase of two NDV isolates sampled from infected farms in Iran. The samples were collected from flocks that had been vaccinated by both types of live and killed vaccines for NDV. After isolation of NDV, the viruses were subjected to the polymerase chain reaction (PCR) amplification using two pairs of specific primers designed for the HN gene to amplify the complete HN gene (1730bp). Afterward, the PCR products were sequenced and analyzed by phylogenetic tree construction software. Based on the analysis, substantial sequence homology among Iranian isolates is within the range of 97.1-100%. Moreover, the sequence homology searching revealed a level of similarity between HN sequences of Iranian isolates and the HN sequences from other countries, particularly Asian ones. For instance, a high homology ratio (95.34%) was found between Iranian isolates and the sequences registered on online molecular databases from China. Based on phylogenetic analysis, the NDV isolates belong to the VIId genotype. Finally, it can be concluded that monitoring the circulation of NDVs among poultry and other birds can help to obtain an insight into the evolution of NDVs and control of panzootic viruses in the future.
| S-EPMC8410199 | biostudies-literature
Project description:Galectin-1 is an important immunoregulatory factor and can mediate the host-pathogen interaction via binding glycans on the surface of various viruses. We previously reported that avian respiratory viruses, including lentogenic Newcastle disease virus (NDV), can induce up-regulation of chicken galectin (CG)-1B in the primary target organ. In this study, we investigated whether CG-1B participated in the infectious process of NDV in chickens. We demonstrated that velogenic NDV induced up-regulation of CG-1B in target organs. We also found that CG-1B directly bound to NDV virions and inhibited their hemagglutination activity in vitro We confirmed that CG-1B interacted with NDV hemagglutinin-neuraminidase (HN) glycoprotein, in which the specific G4 N-glycans significantly contributed to the interaction between CG-1B and HN glycoprotein. The presence of extracellular CG-1B, rather than the internalization process, inhibited adsorption of NDV. The interaction between intracellular CG-1B and NDV HN glycoproteins inhibited cell-surface expression of HN glycoprotein and reduced the titer of progeny virus in NDV-infected DF-1 cells. Significantly, the replication of parental and HN glycosylation mutant viruses in CG-1B knockdown and overexpression cells demonstrated that the replication of NDV was correlated with the expression of CG-1B in a specific glycan-dependent manner. Collectively, our results indicate that CG-1B has anti-NDV activity by binding to N-glycans on HN glycoprotein.
| S-EPMC5724002 | biostudies-literature
Project description:BACKGROUND: To investigate the relationship between the selective pressure and the sequence variation of the hemagglutinin-neuraminidase (HN) protein, we performed the positive selection analysis by estimating the ratio of non-synonymous to synonymous substitutions with 132 complete HN gene sequences of Newcastle disease viruses (NDVs) isolated in China. RESULTS: The PAML software applying a maximum likelihood method was used for the analysis and three sites (residues 266, 347 and 540) in the HN protein were identified as being under positive selection. Codon 347 was located exactly in a recognized antigenic determinant (residues 345-353) and codon 266 in a predicted linear B-cell epitope. Substitutions at codon 540 contributed to the N-linked glycosylation potential of residue 538. To further evaluate the effect of positively selected sites on the vaccine efficacy, we constructed two recombinant fowlpox viruses rFPV-JS6HN and rFPV-LaSHN, expressing the HN proteins from a genotype VII field isolate Go/JS6/05 (with A266, K347 and A540) and vaccine strain La Sota (with V266, E347 and T540), respectively. Two groups of SPF chickens, 18 each, were vaccinated with the two recombinant fowlpox viruses and challenged by Go/JS6/05 at 3 weeks post-immunization. The results showed that rFPV-JS6HN could elicit more effective immunity against the prevalent virus infection than rFPV-LaSHN in terms of reducing virus shedding. CONCLUSIONS: The analysis of positively selected codons and their effect on the vaccine efficacy indicated that the selective pressure on the HN protein can induce antigenic variation, and new vaccine to control the current ND epidemics should be developed.
| S-EPMC3101160 | biostudies-literature
Project description:Newcastle disease virus (NDV), an avian orthoavulavirus, is a causative agent of Newcastle disease named (NDV), and can cause even the epidemics when disease is not treated. Previously several vaccines based on attenuated and inactivated viruses have been reported which are rendered useless with the passage of time due to versatile changes in viral genome. Therefore, we aimed to develop an effective multi-epitope vaccine against the haemagglutinin neuraminidase (HN) protein of 26 NDV strains from Pakistan through a modern immunoinformatic approaches. As a result, a vaccine chimaera was constructed by combining T-cell and B-cell epitopes with the appropriate linkers and adjuvant. The designed vaccine was highly immunogenic, non-allergen and antigenic; therefore, the potential 3D-structureof multi epitope vaccine was constructed, refined and validated. A molecular docking study of a multiepitope vaccine candidate with the chicken Toll-like receptor-4 indicated successful binding. An In silico immunological simulation was used to evaluate the candidate vaccine's ability to elicit an effective immune response. According to the computational studies, the proposed multiepitope vaccine is physically stable and may induce immune responses whichsuggested it a strong candidate against 26 Newcastle disease virus strains from Pakistan.
| S-EPMC9073007 | biostudies-literature