Dataset Information

Improved immunogenicity of Newcastle disease virus inactivated vaccine following DNA vaccination using Newcastle disease virus hemagglutinin-neuraminidase and fusion protein genes.

ABSTRACT: The present study describes the development of DNA vaccines using the hemagglutinin-neuraminidase (HN) and fusion (F) genes from AF2240 Newcastle disease virus strain, namely pIRES/HN, pIRES/F and pIRES-F/HN. Transient expression analysis of the constructs in Vero cells revealed the successful expression of gene inserts in vitro. Moreover, in vivo experiments showed that single vaccination with the constructed plasmid DNA (pDNA) followed by a boost with inactivated vaccine induced a significant difference in enzyme-linked immunosorbent assay antibody levels (p < 0.05) elicited by either pIRES/F, pIRES/F+ pIRES/HN or pIRES-F/HN at one week after the booster in specific pathogen free chickens when compared with the inactivated vaccine alone. Taken together, these results indicated that recombinant pDNA could be used to increase the efficacy of the inactivated vaccine immunization procedure.

SUBMITTER: Firouzamandi M

PROVIDER: S-EPMC4808640 | biostudies-literature | 2016 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Improved immunogenicity of Newcastle disease virus inactivated vaccine following DNA vaccination using Newcastle disease virus hemagglutinin-neuraminidase and fusion protein genes.

Firouzamandi Masoumeh M Moeini Hassan H Hosseini Davood D Bejo Mohd Hair MH Omar Abdul Rahman AR Mehrbod Parvaneh P Ideris Aini A

Journal of veterinary science 20160322 1

The present study describes the development of DNA vaccines using the hemagglutinin-neuraminidase (HN) and fusion (F) genes from AF2240 Newcastle disease virus strain, namely pIRES/HN, pIRES/F and pIRES-F/HN. Transient expression analysis of the constructs in Vero cells revealed the successful expression of gene inserts in vitro. Moreover, in vivo experiments showed that single vaccination with the constructed plasmid DNA (pDNA) followed by a boost with inactivated vaccine induced a significant ...[more]

PMID: 27051336

Similar Datasets

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Dataset Information

Improved immunogenicity of Newcastle disease virus inactivated vaccine following DNA vaccination using Newcastle disease virus hemagglutinin-neuraminidase and fusion protein genes.

Publications

Improved immunogenicity of Newcastle disease virus inactivated vaccine following DNA vaccination using Newcastle disease virus hemagglutinin-neuraminidase and fusion protein genes.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure