Dataset Information

Association between functional polymorphisms of Foxp3 gene and the occurrence of unexplained recurrent spontaneous abortion in a Chinese Han population.

ABSTRACT: Unexplained recurrent spontaneous abortion (URSA) is an alloimmune disease associated with the failure of fetal-maternal immunologic tolerance in which the regulatory T lymphocytes (Treg) play a pivotal role. It is well known that Forkhead box P3 (Foxp3) is a crucial regulatory factor for the development and function of Treg cells. It has also been established that deficiency of the Foxp3 gene suppresses the regulatory function of Treg cells. To determine if functional polymorphisms at the Foxp3 loci are associated with URSA in humans, we genotyped four common polymorphisms of Foxp3 gene in 146 unrelated URSA patients and 112 healthy women. The results showed that rs3761548A/C and rs2232365A/G polymorphisms were significantly associated with URSA. Additionally, we found that the allelic distribution of rs5902434 del/ATT in URSA group was slightly different from that in the control group. We conclude that functional polymorphisms of the Foxp3 gene may confer an important susceptibility to URSA in the Chinese Han population, probably by altering Foxp3 function and/or its expression.

SUBMITTER: Wu Z

PROVIDER: S-EPMC3162971 | biostudies-literature | 2012

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Association between functional polymorphisms of Foxp3 gene and the occurrence of unexplained recurrent spontaneous abortion in a Chinese Han population.

Wu Zaigui Z You Zeshan Z Zhang Cai C Li Zhuyu Z Su Xiumei X Zhang Xiuming X Li Yinguang Y

Clinical & developmental immunology 20110713

Unexplained recurrent spontaneous abortion (URSA) is an alloimmune disease associated with the failure of fetal-maternal immunologic tolerance in which the regulatory T lymphocytes (Treg) play a pivotal role. It is well known that Forkhead box P3 (Foxp3) is a crucial regulatory factor for the development and function of Treg cells. It has also been established that deficiency of the Foxp3 gene suppresses the regulatory function of Treg cells. To determine if functional polymorphisms at the Foxp3 ...[more]

PMID: 21876709

Similar Datasets

Project description:BackgroundRecurrent spontaneous abortion (RSA) refers to 2 or more consecutive pregnancy losses, and RSA with unknown causes is called unexplained recurrent spontaneous abortion (URSA). Tim-3, a subtype of the T-cell immunoglobulin domain and mucin domain (Tim) protein family, might be an important regulatory molecule that plays a pivotal role in URSA, which might be triggered mostly by Th1/Th2 immune deviation. To understand the etiology and pathogenesis of URSA in Han Chinese women, we investigated the association between polymorphisms of rs10053538 and rs10515746 in the promoter of Tim-3 and the risk of URSA in Han Chinese women.MethodsOne hundred and forty-eight women with RSA resulting in still birth were enrolled in the URSA group. We performed tests to rule out congenital reproductive system malformation, reproductive system tumor, endocrine dyscrasia, and chromosome abnormalities. One hundred and fifty-three women with normal pregnancy leading to live birth were selected at random to comprise the control group. All women included in this study were genetically unrelated Han Chinese women. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele-specific polymerase chain reaction (AS-PCR) were used to determine polymorphisms of rs10053538 and rs10515746, respectively, in all subjects. PCR products were chosen at random for sequencing.ResultsNo significant statistical difference was found between the distribution frequency of the GT + TT genotype and T allele on the rs10053538 locus in the URSA group or the control group (10.1% vs. 11.8%, Chi(2) = 0.205, P = 0.651; 5.1% vs. 6.5%, Chi(2) = 0.592, P = 0.441; respectively). Neither was there a significant difference between the distribution frequency of the GT + TT genotype and T allele on the rs10515746 locus in the groups (6.8% vs. 3.9%, Chi(2)1.201, P = 0.273; 3.4% vs. 2.0%, Chi(2) = 1.169, P = 0.280; respectively).ConclusionsThe present study suggested that these polymorphisms of rs10053538 or rs10515746 in the Tim-3 promoter may not be associated with URSA in Han Chinese women.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Association between functional polymorphisms of Foxp3 gene and the occurrence of unexplained recurrent spontaneous abortion in a Chinese Han population.

Publications

Association between functional polymorphisms of Foxp3 gene and the occurrence of unexplained recurrent spontaneous abortion in a Chinese Han population.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets