Dataset Information

The AGT Haplotype of the ESR2 Gene Containing the Polymorphisms rs2077647A, rs4986938G, and rs1256049T Increases the Susceptibility of Unexplained Recurrent Spontaneous Abortion in Women in the Chinese Hui Population.

ABSTRACT: BACKGROUND Estrogen has an important role in unexplained recurrent spontaneous abortion (URSA). Polymorphisms of the ESR1 gene and the ESR2 gene have been identified as risk factors for URSA, but with varied associations in Chinese populations. This study aimed to compare the role of gene polymorphisms of ESR1 and ESR2 and the risk of URSA in the Chinese Hui and Chinese Han populations. MATERIAL AND METHODS Chinese Hui women (n=171) and Chinese Han women (n=234) with URSA were compared with healthy controls (n=417) matched by ethnicity and age. Genotyping was performed using direct sequencing and identified three polymorphisms of the ESR1 gene (rs9340799, rs2234693, and rs3798759) and three polymorphisms of the ESR2 gene (rs207764, rs4986938, and rs1256049). The association between ESR1 and ESR2 gene polymorphisms and the risk of URSA was evaluated statistically using the odds ratio (OR) and 95% confidence interval (CI). RESULTS No association was detected between the allelic, dominant, and recessive models of ESR1 and ESR2 gene polymorphisms and the risk of URSA in Chinese Han and Hui populations (p>0.05). The distribution of the AGT haplotype containing ESR2 gene polymorphisms rs2077647A, rs4986938G, and rs1256049T was significantly reduced in patients with URSA compared with controls in the Chinese Hui population (OR, 0.29; 95% CI, 0.14-0.62; p=0.0009; padj=0.005). CONCLUSIONS The AGT haplotype of the ESR2 gene containing the polymorphism rs2077647A, rs4986938G, and rs1256049T (ESR2 hapAGT) was a protective factor for URSA in women in the Chinese Hui population when compared with the Chinese Han population.

SUBMITTER: Tang D

PROVIDER: S-EPMC7212806 | biostudies-literature | 2020 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

The AGT Haplotype of the ESR2 Gene Containing the Polymorphisms rs2077647A, rs4986938G, and rs1256049T Increases the Susceptibility of Unexplained Recurrent Spontaneous Abortion in Women in the Chinese Hui Population.

Tang Dawei D Bao Junhua J Bai Gang G Hao Miaomiao M Jin Rui R Liu Fang F

Medical science monitor : international medical journal of experimental and clinical research 20200502

BACKGROUND Estrogen has an important role in unexplained recurrent spontaneous abortion (URSA). Polymorphisms of the ESR1 gene and the ESR2 gene have been identified as risk factors for URSA, but with varied associations in Chinese populations. This study aimed to compare the role of gene polymorphisms of ESR1 and ESR2 and the risk of URSA in the Chinese Hui and Chinese Han populations. MATERIAL AND METHODS Chinese Hui women (n=171) and Chinese Han women (n=234) with URSA were compared with heal ...[more]

PMID: 32359133

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Dataset Information

The AGT Haplotype of the ESR2 Gene Containing the Polymorphisms rs2077647A, rs4986938G, and rs1256049T Increases the Susceptibility of Unexplained Recurrent Spontaneous Abortion in Women in the Chinese Hui Population.

Publications

The AGT Haplotype of the ESR2 Gene Containing the Polymorphisms rs2077647A, rs4986938G, and rs1256049T Increases the Susceptibility of Unexplained Recurrent Spontaneous Abortion in Women in the Chinese Hui Population.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets