Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cavitand-functionalized SWCNTs for N-methylammonium detection.

ABSTRACT: Single-walled carbon nanotubes (SWCNTs) have been functionalized with highly selective tetraphosphonate cavitand receptors. The binding of charged N-methylammonium species to the functionalized SWCNTs was analyzed by X-ray photoelectron spectroscopy and confirmed by (31)P MAS NMR spectroscopy. The cavitand-functionalized SWCNTs were shown to function as chemiresistive sensory materials for the detection of sarcosine and its ethyl ester hydrochloride in water with high selectivity at concentrations as low as 0.02 mM. Exposure to sarcosine and its derivative resulted in an increased conductance, in contrast to a decreased conductance response observed for potential interferents such as the structurally related glycine ethyl ester hydrochloride.

SUBMITTER: Dionisio M

PROVIDER: S-EPMC3334860 | biostudies-literature | 2012 Apr

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Cavitand-functionalized SWCNTs for N-methylammonium detection.

Dionisio Marco M Schnorr Jan M JM Michaelis Vladimir K VK Griffin Robert G RG Swager Timothy M TM Dalcanale Enrico E

Journal of the American Chemical Society 20120404 15

Single-walled carbon nanotubes (SWCNTs) have been functionalized with highly selective tetraphosphonate cavitand receptors. The binding of charged N-methylammonium species to the functionalized SWCNTs was analyzed by X-ray photoelectron spectroscopy and confirmed by (31)P MAS NMR spectroscopy. The cavitand-functionalized SWCNTs were shown to function as chemiresistive sensory materials for the detection of sarcosine and its ethyl ester hydrochloride in water with high selectivity at concentratio ...[more]

PMID: 22475006

Similar Datasets

Highly Damage-Resistant Thin Film Saturable Absorber Based on Mechanically Functionalized SWCNTs.

Project description:Thin-film saturable absorbers (SAs) are extensively used in mode-locked fiber laser due to the robust and simple application methods that arise because SAs are alignment-free and self-standing. Single-walled carbon nanotubes (SWCNTs) are the most suitable low dimensional material uesd for SAs because of their high nonlinearity and the wavelength control of absorption based on tube diameters. The most challenging problem with the use of CNT-based thin film SAs is thermal damage caused during high power laser operation, which mainly occurs due to aggregation of CNTs. We have demonstrated improved thermal damage resistance and enhanced durability of a film-type SA based on functionalization of SWCNTs, which were subjected to a mechanical functionalization procedure to induce covalent structural modifications on the SWCNT surface. Increased intertube distance was shown by X-ray diffraction, and partial functionalization was shown by Raman spectroscopy. This physical change had a profound effect on integration with the host polymer and resolved aggregation problems. A free-standing SA was fabricated by the drop casting method, and improved uniformity was shown by scanning electron microscopy. The SA was analyzed using various structural and thermal evaluation techniques (Raman spectroscopy, thermogravimetric analysis, etc.). Damage tests at different optical powers were also performed. To the best of our knowledge, a comprehensive analysis of a film-type SA is reported here for the first time. The partially functionalized SWCNT (fSWCNT) SA shows significant structural integrity after intense damage tests and a modulation depth of 25.3%. In passively mode-locked laser operation, a pulse width of 152 fs is obtained with a repetition rate of 77.8 MHz and a signal-to-noise ratio of 75 dB. Stable operation of the femtosecond fiber laser over 200 h verifies the enhanced durability of the fSWCNT SA.

| S-EPMC8761199 | biostudies-literature

Exclusive recognition of sarcosine in water and urine by a cavitand-functionalized silicon surface.

Project description:A supramolecular approach for the specific detection of sarcosine, recently linked to the occurrence of aggressive prostate cancer forms, has been developed. A hybrid active surface was prepared by the covalent anchoring on Si substrates of a tetraphosphonate cavitand as supramolecular receptor and it was proven able to recognize sarcosine from its nonmethylated precursor, glycine, in water and urine. The entire complexation process has been investigated in the solid state, in solution, and at the solid-liquid interface to determine and weight all the factors responsible of the observed specificity. The final outcome is a Si-based active surface capable of binding exclusively sarcosine. The complete selectivity of the cavitand-decorated surface under these stringent conditions represents a critical step forward in the use of these materials for the specific detection of sarcosine and related metabolites in biological fluids.

| S-EPMC3289311 | biostudies-literature

Flexible and Printed Electrochemical Immunosensor Coated with Oxygen Plasma Treated SWCNTs for Histamine Detection.

Project description:Heterocyclic amine histamine is a well-known foodborne toxicant (mostly linked to "scombroid poisoning") synthesized from the microbial decarboxylation of amino acid histidine. In this work, we report the fabrication of a flexible screen-printed immunosensor based on a silver electrode coated with single-walled carbon nanotubes (SWCNTs) for the detection of histamine directly in fish samples. Biosensors were realized by first spray depositing SWCNTs on the working electrodes and by subsequently treating them with oxygen plasma to reduce the unwanted effects related to their hydrophobicity. Next, anti-histamine antibodies were directly immobilized on the treated SWCNTs. Histamine was detected using the typical reaction of histamine and histamine-labeled with horseradish peroxidase (HRP) competing to bind with anti-histamine antibodies. The developed immunosensor shows a wide linear detection range from 0.005 to 50 ng/mL for histamine samples, with a coefficient of determination as high as 98.05%. Average recoveries in fish samples were observed from 96.00% to 104.7%. The biosensor also shows good selectivity (less than 3% relative response for cadaverine, putrescine, and tyramine), reproducibility, mechanical and time stability, being a promising analytical tool for the analysis of histamine, as well as of other food hazards.

| S-EPMC7235776 | biostudies-literature

Disentanglement of excited-state dynamics with implications for FRET measurements: two-dimensional electronic spectroscopy of a BODIPY-functionalized cavitand.

Project description:Förster Resonance Energy Transfer (FRET) is the incoherent transfer of an electronic excitation from a donor fluorophore to a nearby acceptor. FRET has been applied as a probe of local chromophore environments and distances on the nanoscale by extrapolating transfer efficiencies from standard experimental parameters, such as fluorescence intensities or lifetimes. Competition from nonradiative relaxation processes is often assumed to be constant in these extrapolations, but in actuality, this competition depends on the donor and acceptor environments and can, therefore, be affected by conformational changes. To study the effects of nonradiative relaxation on FRET dynamics, we perform two-dimensional electronic spectroscopy (2DES) on a pair of azaboraindacene (BODIPY) dyes, attached to opposite arms of a resorcin[4]arene cavitand. Temperature-induced switching between two equilibrium conformations, vase at 294 K to kite at 193 K, increases the donor-acceptor distance from 0.5 nm to 3 nm, affecting both FRET efficiency and nonradiative relaxation. By disentangling different dynamics based on lifetimes extracted from a series of 2D spectra, we independently observe nonradiative relaxation, FRET, and residual fluorescence from the donor in both vase to kite conformations. We observe changes in both FRET rate and nonradiative relaxation when the molecule switches from vase to kite, and measure a significantly greater difference in transfer efficiency between conformations than would be determined by standard lifetime-based measurements. These observations show that changes in competing nonradiative processes must be taken into account when highly accurate measurements of FRET efficiency are desired.

| S-EPMC5935064 | biostudies-literature

Surface Engineering of Methylammonium Lead Bromide Perovskite Crystals for Enhanced X-ray Detection.

Project description:The surface quality of lead halide perovskite crystals can extremely influence their optoelectronic properties and device performance. Here, we report a surface engineering crystallization technique in which we in situ grow a polycrystalline methylammonium lead tribromide (MAPbBr3) film on top of bulk mm-sized single crystals. Such MAPbBr3 crystals with a MAPbBr3 passivating film display intense green emission under UV light. X-ray photoelectron spectroscopy demonstrates that these crystals with emissive surfaces are compositionally different from typical MAPbBr3 crystals that show no emission under UV light. Time-resolved photoluminescence and electrical measurements indicate that the MAPbBr3 film/MAPbBr3 crystals possess less surface defects compared to the bare MAPbBr3 crystals. Therefore, X-ray detectors fabricated using the surface-engineered MAPbBr3 crystals provide an almost 5 times improved sensitivity to X-rays and a more stable baseline drift with respect to the typical MAPbBr3 crystals.

| S-EPMC10577767 | biostudies-literature

Tris(methylammonium thiocyanurate) monohydrate.

Project description:In the title compound, 3[(CH(3))(3)HN(+)]·3C(3)H(2)N(3)S(3) (-)·H(2)O, two independent trithio-cyanurate anions construct a planar hydrogen-bonded ribbon with two N-H?S hydrogen bonds linking each pair of adjacent anions in the chain. The third independent anion and the water mol-ecule form a chain by way of N-H?S and O-H?S contacts, which propagates parallel to the ribbon. The chains and ribbons are cross-linked by O-H?S hydrogen bonds, generating sheets. The three independent trimethyl-ammonium cations are contained between the sheets by way of various N-H?S and N-H?N contacts.

| S-EPMC3050359 | biostudies-literature

Dopant-Modulated Conjugated Polymer Enrichment of Semiconducting SWCNTs.

Project description:Conjugated polymer extraction (CPE) is a low-cost, scalable process that can enrich single-walled carbon nanotube (SWCNT) materials in organic media. For other separation methods in aqueous phases, redox chemistry and/or pH control dramatically affect the sorting process of the SWCNTs. We have previously determined that the CPE process can be fine-tuned by adjusting the pH on the tube surface. Here, we systematically studied the effect of redox chemistry on the CPE process by adding organic p-/n-dopants. At a very strong p-/n-doping level, static repulsions dominated the interactions between the tubes and the CPE lost selectivity. When the doping level changed from a medium p-doping to a neutral state, the yield of CPE increased and the selectivity was compromised. We also observed chiral selectivity when a weak p-dopant was used. A photoluminescence excitation mapping under different titration conditions provided more insight into the doping level of the tubes relative to their diameters, chiralities, and redox potentials. We proposed a mechanism for the CPE process. The semiconducting and metallic tubes are separated because of their different solubilities, which are determined by the bundling energy between the tubes and are related to their doping level in polymer solutions.

| S-EPMC6641520 | biostudies-literature

Viral detection using DNA functionalized gold filaments.

Project description:Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.

| S-EPMC2867084 | biostudies-literature

Aptamer-functionalized microgel particles for protein detection.

Project description:Highly sensitive and multiplexed detection of clinically relevant proteins in biologically complex samples is crucial for the advancement of clinical proteomics. In recent years, aptamers have emerged as useful tools for protein analysis due to their specificity and affinity for protein targets as well as their compatibility with particle-based detection systems. In this study, we demonstrate the highly sensitive detection of human ?-thrombin on encoded hydrogel microparticles functionalized with an aptamer capture sequence. We use static imaging and microfluidic flow-through analysis techniques to evaluate the detection capabilities of the microgels in sandwich-assay formats that utilize both aptamers and antibodies for the reporting of target-binding events. Buffers and reagent concentrations were optimized to provide maximum reaction efficiency while still maintaining an assay with a simple workflow that can be easily adapted to the multiplexed detection of other clinically relevant proteins. The three-dimensional, nonfouling hydrogel immobilization scaffold used in this work provides three logs of dynamic range, with a limit of detection of 4 pM using a single aptamer capture species and without the need for spacers or signal amplification.

| S-EPMC4042682 | biostudies-literature

Resorcinol Functionalized Gold Nanoparticles for Formaldehyde Colorimetric Detection.

Project description:Gold nanoparticles functionalized with resorcinol moieties have been prepared and used for detecting formaldehyde both in solution and gas phases. The detection mechanism is based on the color change of the probe upon the aggregation of the nanoparticles induced by the polymerization of the resorcinol moieties in the presence of formaldehyde. A limit of detection of 0.5 ppm in solution has been determined. The probe can be deployed for the detection of formaldehyde emissions from composite wood boards.

| S-EPMC6409679 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data