Dataset Information

Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.

ABSTRACT: Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15-35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within known genes may have escaped previous screenings. Here, we searched for deletions within recently identified SOX10 regulatory sequences and describe the first characterization of a WS4 patient presenting with a large deletion encompassing three of these enhancers. Analysis of the breakpoint region suggests a complex rearrangement involving three Alu sequences that could be mediated by a FosTes/MMBIR replication mechanism. Taken together with recent reports, our results demonstrate that the disruption of highly conserved non-coding elements located within or at a long distance from the coding sequences of key genes can result in several neurocristopathies. This opens up new routes to the molecular dissection of neural crest disorders.

SUBMITTER: Bondurand N

PROVIDER: S-EPMC3421117 | biostudies-literature | 2012 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.

Bondurand Nadége N Fouquet Virginie V Baral Viviane V Lecerf Laure L Loundon Natalie N Goossens Michel M Duriez Benedicte B Labrune Philippe P Pingault Veronique V

European journal of human genetics : EJHG 20120229 9

Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15-35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within kn ...[more]

PMID: 22378281

Similar Datasets

Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30?), c.207_8 delCG (p.Cys71Hisfs?62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs?42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs?117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Dataset Information

Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.

Publications

Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets