A novel SOX10 variant in a Japanese girl with Waardenburg syndrome type 4C and Kallmann syndrome.
Ontology highlight
ABSTRACT:
SUBMITTER: Hamada J
PROVIDER: S-EPMC7522263 | biostudies-literature | 2020
REPOSITORIES: biostudies-literature
Publications
A novel <i>SOX10</i> variant in a Japanese girl with Waardenburg syndrome type 4C and Kallmann syndrome.
Hamada Junpei J Ochi Fumihiro F Sei Yuka Y Takemoto Koji K Hirai Hiroki H Honda Misa M Shibata Hironori H Hasegawa Tomonobu T Eguchi Mariko M
Human genome variation 20200928
We report the first case of Waardenburg syndrome type 4C and Kallmann syndrome in the same person. The patient, a Japanese girl, presented with bilateral iris depigmentation, bilateral sensorineural hearing loss, Hirschsprung disease, hypogonadotropic hypogonadism, and anosmia. We identified a novel <i>SOX10</i> variant, c.124delC, p.Leu42Cysfs*67. ...[more]
Similar Datasets
Project description:A 5-month-old patient presented with grayish-blue iris bilaterally, skin and mucosal pigmentation loss, Hirschsprung's disease, full-blown growth retardation, and sensorineural deafness. The patient's whole exon gene sequencing revealed a spontaneous heterozygous code-shifting mutation in the SOX10 gene: c.803del:p.K268Sfs*18. The parents of the child were wild-type, and the site of the mutation is novel.
| S-EPMC9441800 | biostudies-literature
Project description:ObjectiveTo explore the molecular etiology of Waardenburg syndrome type II (WS2) in a family from Yunnan province, China.MethodsA total of 406 genes related to hereditary hearing loss were sequenced using next-generation sequencing. DNA samples were isolated from the peripheral blood DNA of probands. Those pathogenic mutations detected by next-generation sequencing in probands and their parents were validated by Sanger sequencing. The conservatism of variation sites in genes was also analyzed. The protein expression was detected by flow cytometry.ResultsA heterozygous mutation c.178delG (p.D60fs*49) in the SOX10 gene was identified in the proband, which is a frameshift mutation and may cause protein loss of function and considered to be a pathogenic mutation. This was determined to be a de novo mutation because her family were demonstrated to be wild-type and symptom free. SOX10, FGFR3, SOX2, and PAX3 protein levels were reduced as determined by flow cytometry.ConclusionA novel frameshift mutation in SOX10 gene was identified in this study, which may be the cause of WS2 in proband. In addition, FGFR3, SOX2, and PAX3 might also participate in promoting the progression of WS2.
| S-EPMC10958176 | biostudies-literature
Project description:Waardenburg syndrome (WS), also known as auditory-pigmentary syndrome, is the most common cause of syndromic hearing loss. It is responsible for 2-5% of congenital deafness. WS is classified into four types depending on the clinical phenotypes. Currently, pathogenic mutation of PAX3, MITF, EDNRB, EDN3, SNAI2, or SOX10 can cause corresponding types of WS. Among them, SOX10 mutation is responsible for approximately 15% of type II WS or 50% of type IV WS. We report the case of a proband in a Chinese family who was diagnosed with WS type II. Whole exome sequencing (WES) of the proband detected a novel heterozygous spontaneous mutation: SOX10 c.246delC. According to analysis based on nucleic acid and amino acid sequences, this mutation may produce a truncated protein, with loss of the HMG structure domain. Therefore, this truncated protein may fail to activate the expression of the MITF gene, which regulates melanocytic development and plays a key role in WS. Our finding expands the database of SOX10 mutations associated with WS and provides more information regarding the molecular mechanism of WS.
| S-EPMC7474791 | biostudies-literature
Project description:Objective: Waardenburg syndrome type 2 (WS2) is an autosomal dominant syndrome, characterized by bright blue eyes, hearing loss, and depigmented patches of hair and skin. It exhibits high phenotypic and genetic heterogeneity. We explored the molecular etiology in a Chinese family with WS2.Methods: We recruited a three-generation family with three affected members. Medical history was obtained from all family members who underwent detailed physical examinations and audiology tests. Genomic DNA was extracted from peripheral blood of each individual, and 139 candidate genes associated with hearing loss were sequenced using Illumina HiSeq 2000 (Illumina Inc., San Diego, CA, USA) and verified by Sanger sequencing.Results: Genetic evaluation revealed a novel nonsense heterozygous variant, NM_006941.4: c.342G>A (p.Trp114Ter) in exon 2 of the SOX10 gene in the three affected patients; no unaffected family member carried the variation. We did not detect the variation in 500 Chinese individuals with normal hearing or in 122 unrelated Chinese families with hearing loss, suggesting that it was specific to our patients.Conclusions: We identified a novel heterozygous nonsense variation in a family with syndromic hearing loss and WS2. Our findings expand the pathogenic spectrum and strengthen the clinical diagnostic role of SOX10 in patients with WS2.
| S-EPMC7708717 | biostudies-literature
Project description:Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15-35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within known genes may have escaped previous screenings. Here, we searched for deletions within recently identified SOX10 regulatory sequences and describe the first characterization of a WS4 patient presenting with a large deletion encompassing three of these enhancers. Analysis of the breakpoint region suggests a complex rearrangement involving three Alu sequences that could be mediated by a FosTes/MMBIR replication mechanism. Taken together with recent reports, our results demonstrate that the disruption of highly conserved non-coding elements located within or at a long distance from the coding sequences of key genes can result in several neurocristopathies. This opens up new routes to the molecular dissection of neural crest disorders.
| S-EPMC3421117 | biostudies-literature
Project description:Waardenburg syndrome (WS) is a rare auditory-pigmentary disorder that exhibits varying combinations of sensorineural hearing loss and pigmentation defects. Four subtypes are clinically defined based on the presence or absence of additional symptoms. WS type 2 (WS2) can result from mutations within the MITF or SOX10 genes; however, 70% of WS2 cases remain unexplained at the molecular level, suggesting that other genes might be involved and/or that mutations within the known genes escaped previous screenings. The recent identification of a deletion encompassing three of the SOX10 regulatory elements in a patient presenting with another WS subtype, WS4, defined by its association with Hirschsprung disease, led us to search for deletions and point mutations within the MITF and SOX10 regulatory elements in 28 yet unexplained WS2 cases. Two nucleotide variations were identified: one in close proximity to the MITF distal enhancer (MDE) and one within the U1 SOX10 enhancer. Functional analyses argued against a pathogenic effect of these variations, suggesting that mutations within regulatory elements of WS genes are not a major cause of this neurocristopathy.
| S-EPMC3407046 | biostudies-literature
Project description:Waardenburg syndrome type 1 (WS1) is a rare autosomal dominant disorder characterized by hair hypopigmentation, abnormal iris pigmentation, and congenital hearing loss. WS1 is caused by mutations in paired box gene 3 (PAX3). We identified a novel PAX3 mutation (c.1107 C>G, p.Ser369Arg) in a Japanese WS1 patient showing abnormal right iris pigmentation, right-sided congenital hearing loss, synophrys, incomplete left cleft lip, and cryptorchidism.
| S-EPMC4775770 | biostudies-literature
Project description:Waardenburg syndrome type 4 (WS4), also called Shah-Waardenburg syndrome, is a rare neurocristopathy that results from the absence of melanocytes and intrinsic ganglion cells of the terminal hindgut. WS4 is inherited as an autosomal recessive trait attributable to EDN3 or EDNRB mutations. It is inherited as an autosomal dominant condition when SOX10 mutations are involved. We report on three unrelated WS4 patients with growth retardation and an as-yet-unreported neurological phenotype with impairment of both the central and autonomous nervous systems and occasionally neonatal hypotonia and arthrogryposis. Each of the three patients was heterozygous for a SOX10 truncating mutation (Y313X in two patients and S251X [corrected] in one patient). The extended spectrum of the WS4 phenotype is relevant to the brain expression of SOX10 during human embryonic and fetal development. Indeed, the expression of SOX10 in human embryo was not restricted to neural-crest-derived cells but also involved fetal brain cells, most likely of glial origin. These data emphasize the important role of SOX10 in early development of both neural-crest-derived tissues, namely melanocytes, autonomic and enteric nervous systems, and glial cells of the central nervous system.
| S-EPMC1378013 | biostudies-other
Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30?), c.207_8 delCG (p.Cys71Hisfs?62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs?42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs?117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.
| S-EPMC7756068 | biostudies-literature
Project description:BackgroundThe objective of this study was to investigate the genetic causes of two probands diagnosed as Waardenburg syndrome (WS type I and IV) from two unrelated Chinese families.MethodsPAX3 and SOX10 were the main pathogenic genes for WS type I (WS I) and IV (WS IV), respectively; all coding exons of these genes were sequenced on the two probands and their family members. Luciferase reporter assay and co-immunoprecipitation (CO-IP) were conducted to verify potential functional outcomes of the novel mutations.ResultsThe first proband is a 9 years old girl diagnosed with WS I. A novel PAX3 heterozygous mutation of c.372-373delGA (p.N125fs) was identified, which results in a frameshift and truncation of PAX3 protein. In family II, a 2 years old girl was diagnosed with WS IV, and Sanger sequencing revealed a de novo SOX10 mutation of c.1114insTGGGGCCCCCACACTACACCGAC (p.Q372fs), a frameshift mutation that extends the amino acid chain of SOX10 protein. Functional studies indicated that the novel mutation of SOX10 had no effects on the interaction of SOX10 and PAX3, but reduced transactivate capacity of melanocyte inducing transcription factor (MITF) promoter. Both PAX3 and SOX10 mutation-induced defects of MITF transcription might contribute to the WS pathogenesis.ConclusionWe revealed a novel mutation in PAX3 and a de novo mutation in SOX10, which might account for the underlying pathogenesis of WS. This study expands the database of both PAX10 and PAX3 mutations and improves our understanding of the causes of WS.
| S-EPMC7216796 | biostudies-literature