Case report: Heterogeneous mutations of SOX10 gene in a Chinese infant with Waardenburg syndrome type 4C.
Ontology highlight
ABSTRACT:
SUBMITTER: Zhang S
PROVIDER: S-EPMC9441800 | biostudies-literature | 2022
REPOSITORIES: biostudies-literature
Publications
Case report: Heterogeneous mutations of SOX10 gene in a Chinese infant with Waardenburg syndrome type 4C.
Zhang Suli S Lin Shuangzhu S Liu Zhenxian Z Wang Wanqi W Li Jiayi J Chen Qiandui Q Yang Li L Wang Cui C Pang Qiming Q
Frontiers in pediatrics 20220822
A 5-month-old patient presented with grayish-blue iris bilaterally, skin and mucosal pigmentation loss, Hirschsprung's disease, full-blown growth retardation, and sensorineural deafness. The patient's whole exon gene sequencing revealed a spontaneous heterozygous code-shifting mutation in the SOX10 gene: c.803del:p.K268Sfs<sup>*</sup>18. The parents of the child were wild-type, and the site of the mutation is novel. ...[more]
Similar Datasets
Project description:We report the first case of Waardenburg syndrome type 4C and Kallmann syndrome in the same person. The patient, a Japanese girl, presented with bilateral iris depigmentation, bilateral sensorineural hearing loss, Hirschsprung disease, hypogonadotropic hypogonadism, and anosmia. We identified a novel SOX10 variant, c.124delC, p.Leu42Cysfs*67.
| S-EPMC7522263 | biostudies-literature
Project description: Not available
| S-EPMC11040914 | biostudies-literature
Project description:BackgroundWaardenburg syndrome (WS) is a rare genetic disorder. The purpose of this study was to investigate clinical and molecular characteristics of WS in four probands from four different Iranian families.Case presentationThe first patient was a 1-year-old symptomatic boy with congenital hearing loss and heterochromia iridis with a blue segment in his left iris. The second case was a 1.5-year-old symptomatic girl who manifested congenital profound hearing loss, brilliant blue eyes, and skin hypopigmentation on the abdominal region at birth time. The third patient was an 8-month-old symptomatic boy with developmental delay, mild atrophy, hypotonia, brilliant blue eyes, skin hypopigmentation on her hand and foot, Hirschsprung disease, and congenital profound hearing loss; the fourth patient was a 4-year-old symptomatic boy who showed dystopia canthorum, broad nasal root, synophrys, skin hypopigmentation on her hand and abdomen, brilliant blue eyes, and congenital profound hearing loss. Whole exome sequencing (WES) was used for each proband to identify the underlying genetic factor. Sanger sequencing was performed for validation of the identified mutations in probands and the available family members. A novel heterozygous frameshift mutation, c.996delT (p.K334Sfs*15), on exon 8 of the MITF gene was identified in the patient of the first family diagnosed with WS2A. Two novel de novo heterozygous mutations including a missense mutation, c.950G > A (p.R317K), on exon 8 of the MITF gene, and a frameshift mutation, c.684delC (p.E229Sfs*57), on the exon 3 of the SOX10 gene were detected in patients of the second and third families with WS2A and PCWH (Peripheral demyelinating neuropathy, Central dysmyelinating leukodystrophy, Waardenburg syndrome, Hirschsprung disease), respectively. A previously reported heterozygous frameshift mutation, c.1024_1040del AGCACGATTCCTTCCAA, (p.S342Pfs*62), on exon 7 of the PAX3 gene was identified in the patient of the fourth family with WS1.ConclusionsAn exact description of the mutations responsible for WS provides useful information to explain the molecular cause of clinical features of WS and contributes to better genetic counseling of WS patients and their families.
| S-EPMC7869501 | biostudies-literature
Project description:Background and purposeWaardenburg syndrome, characterized by deafness and pigmentation abnormalities, is clinically and genetically heterogeneous, consisting of 4 distinct subtypes and involving several genes. SOX10 mutations have been found both in types 2 and 4 Waardenburg syndrome and neurologic variants. The purpose of this study was to evaluate both the full spectrum and relative frequencies of inner ear malformations in these patients.Materials and methodsFifteen patients with Waardenburg syndrome and different SOX10 mutations were studied retrospectively. Imaging was performed between February 2000 and March 2010 for cochlear implant work-up, diagnosis of hearing loss, and/or evaluation of neurologic impairment. Eleven patients had both CT and MR imaging examinations, 3 had MR imaging only, and 1 had CT only.ResultsTemporal bone abnormalities were bilateral. The most frequent pattern associated agenesis or hypoplasia of ≥1 semicircular canal, an enlarged vestibule, and a cochlea with a reduced size and occasionally an abnormal shape, but with normal partition in the 13/15 cases that could be analyzed. Three patients lacked a cochlear nerve, bilaterally in 2 patients. In addition, associated abnormalities were found when adequate MR imaging sequences were available: agenesis of the olfactory bulbs (7/8), hypoplastic or absent lacrimal glands (11/14), hypoplastic parotid glands (12/14), and white matter signal anomalies (7/13).ConclusionsIn the appropriate clinical context, bilateral agenesis or hypoplasia of the semicircular canals or both, associated with an enlarged vestibule and a cochlear deformity, strongly suggests a diagnosis of Waardenburg syndrome linked to a SOX10 mutation.
| S-EPMC7964579 | biostudies-literature
Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.
| S-EPMC7756068 | biostudies-literature
Project description:BackgroundThe objective of this study was to investigate the genetic causes of two probands diagnosed as Waardenburg syndrome (WS type I and IV) from two unrelated Chinese families.MethodsPAX3 and SOX10 were the main pathogenic genes for WS type I (WS I) and IV (WS IV), respectively; all coding exons of these genes were sequenced on the two probands and their family members. Luciferase reporter assay and co-immunoprecipitation (CO-IP) were conducted to verify potential functional outcomes of the novel mutations.ResultsThe first proband is a 9 years old girl diagnosed with WS I. A novel PAX3 heterozygous mutation of c.372-373delGA (p.N125fs) was identified, which results in a frameshift and truncation of PAX3 protein. In family II, a 2 years old girl was diagnosed with WS IV, and Sanger sequencing revealed a de novo SOX10 mutation of c.1114insTGGGGCCCCCACACTACACCGAC (p.Q372fs), a frameshift mutation that extends the amino acid chain of SOX10 protein. Functional studies indicated that the novel mutation of SOX10 had no effects on the interaction of SOX10 and PAX3, but reduced transactivate capacity of melanocyte inducing transcription factor (MITF) promoter. Both PAX3 and SOX10 mutation-induced defects of MITF transcription might contribute to the WS pathogenesis.ConclusionWe revealed a novel mutation in PAX3 and a de novo mutation in SOX10, which might account for the underlying pathogenesis of WS. This study expands the database of both PAX10 and PAX3 mutations and improves our understanding of the causes of WS.
| S-EPMC7216796 | biostudies-literature
Project description:Waardenburg syndrome type 4 (WS4) or Waardenburg-Shah syndrome is a rare genetic disorder with a prevalence of <1/1,000,000 and characterized by the association of congenital sensorineural hearing loss, pigmentary abnormalities, and intestinal aganglionosis. There are three types of WS4 (WS4A-C) caused by mutations in endothelin receptor type B, endothelin 3, and SRY-box 10 (SOX10), respectively. This study investigated a genetic mutation in a Chinese family with one WS4 patient in order to improve genetic counselling. Genomic DNA was extracted, and mutation analysis of the three WS4 related genes was performed using Sanger sequencing. We detected a de novo heterozygous deletion mutation [c.1333delT (p.Ser445Glnfs*57)] in SOX10 in the patient; however, this mutation was absent in the unaffected parents and 40 ethnicity matched healthy controls. Subsequent phylogenetic analysis and three-dimensional modelling of the SOX10 protein confirmed that the c.1333delT heterozygous mutation was pathogenic, indicating that this mutation might constitute a candidate disease-causing mutation.
| S-EPMC5269737 | biostudies-literature
Project description:Waardenburg syndrome (WS) is a congenital hereditary disease, attributed to the most common symptoms of sensorineural deafness and iris hypopigmentation. It is also known as the hearing-pigmentation deficient syndrome. Mutations on SOXl0 gene often lead to congenital deafness and has been shown to play an important role in the pathogenesis of WS. We investigated one family of five members, with four patients exhibiting the classic form of WS2, whose DNA samples were analyzed by the technique of Whole-exome sequencing (WES). From analysis of WES data, we found that both the mother and all three children in the family have a heterozygous mutation on the Sex Determining Region Y - Box 10 (SOX10) gene. The mutation was c.298_300delinsGG in exon 2 of SOX10 (NM_006941), which leads to a frameshift of nine nucleotides, hence the amino acids (p. S100Rfs*9) are altered and the protein translation may be terminated prematurely. Further flow cytometry confirmed significant down-regulation of SOX10 protein, which indicated the SOX10 gene mutation was responsible for the pathogenesis of WS2 patients. In addition, we speculated that some other mutated genes might be related to disease phenotype in this family, which might also participate in promoting the progression of WS2.
| S-EPMC8217986 | biostudies-literature
Project description:Background: Waardenburg syndrome (WS) is a rare genetic disorder characterized by congenital sensorineural hearing loss and pigmentary abnormalities of the hair, skin and eyes. However, exotropia is rarely reported. The purpose of this study is to describe the clinical characteristics of three sporadic patients with WS and congenital exotropia and to investigate the disease-causing genes for them. Methods: Patients underwent detailed physical and ocular examinations. Ocular alignment and binocular status were evaluated. DNA was extracted and whole exome sequencing was performed to detect the pathogenic variations in the disease-causing genes for WS. Cloning sequencing was carried out for those indel variations. Results: Three unrelated patients were diagnosed with Waardenburg syndrome and congenital exotropia. Four novel variants, including c.136delA (p.I46Sfs*64) and c.668G>T (p.R223L) in PAX3, c.709dupC (p.Q237Pfs*119) in COL11A2, c.426G>A (p.W142X) in SOX10 gene, were detected in this study. Conclusion: Simultaneous presence of congenital exotropia and WS in our patients is suggested that WS could be involved in malfunction in the multiple nerve systems. Our genetic study will expand the mutation spectrum of PAX3, COL11A2 and SOX10 genes, and is helpful for further study on the molecular pathogenesis of WS.
| S-EPMC9478892 | biostudies-literature
Project description:ObjectiveTo explore the molecular etiology of Waardenburg syndrome type II (WS2) in a family from Yunnan province, China.MethodsA total of 406 genes related to hereditary hearing loss were sequenced using next-generation sequencing. DNA samples were isolated from the peripheral blood DNA of probands. Those pathogenic mutations detected by next-generation sequencing in probands and their parents were validated by Sanger sequencing. The conservatism of variation sites in genes was also analyzed. The protein expression was detected by flow cytometry.ResultsA heterozygous mutation c.178delG (p.D60fs*49) in the SOX10 gene was identified in the proband, which is a frameshift mutation and may cause protein loss of function and considered to be a pathogenic mutation. This was determined to be a de novo mutation because her family were demonstrated to be wild-type and symptom free. SOX10, FGFR3, SOX2, and PAX3 protein levels were reduced as determined by flow cytometry.ConclusionA novel frameshift mutation in SOX10 gene was identified in this study, which may be the cause of WS2 in proband. In addition, FGFR3, SOX2, and PAX3 might also participate in promoting the progression of WS2.
| S-EPMC10958176 | biostudies-literature