Browse
Submit Data
Databases
API
Help

Dataset Information

13 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Discovering aptamers by cell-SELEX against human soluble growth factors ectopically expressed on yeast cell surface.

ABSTRACT: SELEX, the process of selecting aptamers, is often hampered by the difficulty of preparing target molecules in their native forms and by a lack of a simple yet quantitative assay for monitoring enrichment and affinity of reactive aptamers. In this study, we sought to discover DNA aptamers against human serum markers for potential therapeutic and diagnostic applications. To circumvent soluble expression and immobilization for performing SELEX, we ectopically expressed soluble growth factors on the surface of yeast cells to enable cell-SELEX and devised a flow cytometry-based method to quantitatively monitor progressive enrichment of specific aptamers. High-throughput sequencing of selected pools revealed that the emergence of highly enriched sequences concurred with the increase in the percentage of reactive aptamers shown by flow cytometry. Particularly, selected DNA aptamers against VEGF were specific and of high affinity (K(D) = ∼ 1 nM) and demonstrated a potent inhibition of capillary tube formation of endothelial cells, comparable to the effect of a clinically approved anti-VEGF antibody drug, bevacizumab. Considering the fact that many mammalian secretory proteins have been functionally expressed in yeast, the strategy of implementing cell-SELEX and quantitative binding assay can be extended to discover aptamers against a broad array of soluble antigens.

SUBMITTER: Meng HW

PROVIDER: S-EPMC3968096 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Evolution of Complex Target SELEX to Identify Aptamers against Mammalian Cell-Surface Antigens.

Project description:The demand has increased for sophisticated molecular tools with improved detection limits. Such molecules should be simple in structure, yet stable enough for clinical applications. Nucleic acid aptamers (NAAs) represent a class of molecules able to meet this demand. In particular, aptamers, a class of small nucleic acid ligands that are composed of single-stranded modified/unmodified RNA/DNA molecules, can be evolved from a complex library using Systematic Evolution of Ligands by EXponential enrichment (SELEX) against almost any molecule. Since its introduction in 1990, in stages, SELEX technology has itself undergone several modifications, improving selection and broadening the repertoire of targets. This review summarizes these milestones that have pushed the field forward, allowing researchers to generate aptamers that can potentially be applied as therapeutic and diagnostic agents.

| S-EPMC5572134 | biostudies-other

Identification of malaria parasite-infected red blood cell surface aptamers by inertial microfluidic SELEX (I-SELEX).

Project description:Plasmodium falciparum malaria parasites invade and remodel human red blood cells (RBCs) by trafficking parasite-synthesized proteins to the RBC surface. While these proteins mediate interactions with host cells that contribute to disease pathogenesis, the infected RBC surface proteome remains poorly characterized. Here we use a novel strategy (I-SELEX) to discover high affinity aptamers that selectively recognize distinct epitopes uniquely present on parasite-infected RBCs. Based on inertial focusing in spiral microfluidic channels, I-SELEX enables stringent partitioning of cells (efficiency ≥ 10(6)) from unbound oligonucleotides at high volume throughput (~2 × 10(6) cells min(-1)). Using an RBC model displaying a single, non-native antigen and live malaria parasite-infected RBCs as targets, we establish suitability of this strategy for de novo aptamer selections. We demonstrate recovery of a diverse set of aptamers that recognize distinct, surface-displayed epitopes on parasite-infected RBCs with nanomolar affinity, including an aptamer against the protein responsible for placental sequestration, var2CSA. These findings validate I-SELEX as a broadly applicable aptamer discovery platform that enables identification of new reagents for mapping the parasite-infected RBC surface proteome at higher molecular resolution to potentially contribute to malaria diagnostics, therapeutics and vaccine efforts.

| S-EPMC4486934 | biostudies-literature

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.

2022-02-23 | GSE197262 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

Novel Approach to Overcome Defects of Cell-SELEX in Developing Aptamers against Aspartate β-Hydroxylase.

Project description:Cell-based aptamer selection (Cell-SELEX) against predefined protein targets that benefits using the native form of the targets is the most promising approach to achieve aptamer probes capable of recognizing targets under both in vitro and in vivo conditions. The major disadvantages in Cell-SELEX are the imperfectness of the negative selection step and the lengthy procedure of selection. Here, we introduced the Counter-SELEX as part of our modified Cell-SELEX and implemented deep sequencing to overcome these shortcomings in developing aptamers against aspartate β-hydroxylase (ASPH) as a known tumor marker. In parallel with the conventional Cell-SELEX, five consecutive cycles of counter selection were accomplished using sequences bound to negative cells (the Counter-SELEX) to detect oligos that are not specific for ASPH. After high-throughput sequencing, the representative of each promising achieved family was subjected to further confirmatory analysis via flow cytometry, followed by the fluorescence immunostaining of histopathological sections. Implementing our innovative complementary method, annoying mis-selected sequences in Cell-SELEX enriched pools were effectively identified and removed. According to the affinity assay on the cells displaying ASPH, three aptamers, AP-Cell 1, AP-Cell 2, and AP-Cell 3, with K d values of 47.51, 39.38, and 65.23 nM, respectively, were obtained, while AP-Cell 1 and 3 could then successfully spot ASPH displayed on the tissues. Our study showed that the Counter-SELEX could be considered as a complementary method for Cell-SELEX to overcome the imperfectness of the negative selection step. Moreover, high-throughput nucleotide sequencing could help to shorten the overall process.

| S-EPMC8153902 | biostudies-literature

CRISPR-Mediated Isogenic Cell-SELEX Approach for Generating Highly Specific Aptamers Against Native Membrane Proteins.

Project description:IntroductionThe generation of affinity reagents that bind native membrane proteins with high specificity remains challenging. Most in vitro selection paradigms utilize different cell types for positive and negative rounds of selection (where the positive selection is against a cell that expresses the desired membrane protein and the negative selection is against a cell that lacks the protein). However, this strategy can yield affinity reagents that bind unintended membrane proteins on the target cells. To address this issue, we developed a systematic evolution of ligands by exponential enrichment (SELEX) scheme that utilizes isogenic pairs of cells generated via CRISPR techniques.MethodsUsing a Caco-2 epithelial cell line with constitutive Cas9 expression, we knocked out the SLC2A1 gene (encoding the GLUT1 glucose transporter) via lipofection with synthetic gRNAs. Cell-SELEX rounds were carried out against wild-type and GLUT1-null cells using a single-strand DNA (ssDNA) library. Next-generation sequencing (NGS) was used to quantify enrichment of prospective binders to the wild-type cells.Results10 rounds of cell-SELEX were conducted via simultaneous exposure of ssDNA pools to wild-type and GLUT1-null Caco-2 cells under continuous perfusion. The top binders identified from NGS were validated by flow cytometry and immunostaining for their specificity to the GLUT1 receptor.ConclusionsOur data indicate that highly specific aptamers can be isolated with a SELEX strategy that utilizes isogenic cell lines. This approach may be broadly useful for generating affinity reagents that selectively bind to membrane proteins in their native conformations on the cell surface.

| S-EPMC7596163 | biostudies-literature

Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX.

Project description:The B-lymphocyte antigen (CD20) is a suitable target for single-stranded (ss) nucleic acid oligomer (aptamers). The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX). The cDNA clone of CD20 (pcDNA-CD20) was transfected to human embryonic kidney (HEK293T) cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (?GAP-1 = -10.87 kcal/mol) with the highest binding affinity to CD20 (96.91 ± 4.5 nM). Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

| S-EPMC6017093 | biostudies-literature

RAPID-SELEX for RNA aptamers.

Project description:Aptamers are high-affinity ligands selected from DNA or RNA libraries via SELEX, a repetitive in vitro process of sequential selection and amplification steps. RNA SELEX is more complicated than DNA SELEX because of the additional transcription and reverse transcription steps. Here, we report a new selection scheme, RAPID-SELEX (RNA Aptamer Isolation via Dual-cycles SELEX), that simplifies this process by systematically skipping unnecessary amplification steps. Using affinity microcolumns, we were able to complete a multiplex selection for protein targets, CHK2 and UBLCP1, in a third of the time required for analogous selections using a conventional SELEX approach. High-throughput sequencing of the enriched pools from both RAPID and SELEX revealed many identical candidate aptamers from the starting pool of 5 × 10(15) sequences. For CHK2, the same sequence was preferentially enriched in both selections as the top candidate and was found to bind to its respective target. These results demonstrate the efficiency and, most importantly, the robustness of our selection scheme. RAPID provides a generalized approach that can be used with any selection technology to accelerate the rate of aptamer discovery, without compromising selection performance.

| S-EPMC3869713 | biostudies-literature

Characterization of homing endonuclease binding and cleavage specificities using yeast surface display SELEX (YSD-SELEX).

Project description:LAGLIDADG homing endonucleases (LHEs) are a class of rare-cleaving nucleases that possess several unique attributes for genome engineering applications. An important approach for advancing LHE technology is the generation of a library of design ‘starting points’ through the discovery and characterization of natural LHEs with diverse specificities. However, while identification of natural LHE proteins by sequence homology from genomic and metagenomic sequence databases is straightforward, prediction of corresponding target sequences from genomic data remains challenging. Here, we describe a general approach that we developed to circumvent this issue that combines two technologies: yeast surface display (YSD) of LHEs and systematic evolution of ligands via exponential enrichment (SELEX). Using LHEs expressed on the surface of yeast, we show that SELEX can yield binding specificity motifs and identify cleavable LHE targets using a combination of bioinformatics and biochemical cleavage assays. This approach, which we term YSD-SELEX, represents a simple and rapid first principles approach to determining the binding and cleavage specificity of novel LHEs that should also be generally applicable to any type of yeast surface expressible DNA-binding protein. In this marriage, SELEX adds DNA specificity determination to the YSD platform, and YSD brings diagnostics and inexpensive, facile protein-matrix generation to SELEX.

| S-EPMC5388424 | biostudies-literature

Identification of DNA aptamers toward epithelial cell adhesion molecule via cell-SELEX.

Project description:The epithelial cell adhesion molecule (EpCAM, also known as CD326) is a transmembrane glycoprotein that is specifically detected in most adenocarcinomas and cancer stem cells. In this study, we performed a Cell systematic evolution of ligands by exponential enrichment (SELEX) experiment to isolate the aptamers against EpCAM. After seven round of Cell SELEX, we identified several aptamer candidates. Among the selected aptamers, EP166 specifically binds to cells expressing EpCAM with an equilibrium dissociation constant (Kd) in a micromolar range. On the other hand, it did not bind to negative control cells. Moreover, EP166 binds to J1ES cells, a mouse embryonic stem cell line. Therefore, the isolated aptamers against EpCAM could be used as a stem cell marker or in other applications in both stem cell and cancer studies.

| S-EPMC4213765 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data