Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Evolution of Complex Target SELEX to Identify Aptamers against Mammalian Cell-Surface Antigens.

ABSTRACT: The demand has increased for sophisticated molecular tools with improved detection limits. Such molecules should be simple in structure, yet stable enough for clinical applications. Nucleic acid aptamers (NAAs) represent a class of molecules able to meet this demand. In particular, aptamers, a class of small nucleic acid ligands that are composed of single-stranded modified/unmodified RNA/DNA molecules, can be evolved from a complex library using Systematic Evolution of Ligands by EXponential enrichment (SELEX) against almost any molecule. Since its introduction in 1990, in stages, SELEX technology has itself undergone several modifications, improving selection and broadening the repertoire of targets. This review summarizes these milestones that have pushed the field forward, allowing researchers to generate aptamers that can potentially be applied as therapeutic and diagnostic agents.

SUBMITTER: Mallikaratchy P

PROVIDER: S-EPMC5572134 | biostudies-other | 2017 Jan

REPOSITORIES: biostudies-other

ACCESS DATA

Json Xml

Similar Datasets

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.

2022-02-23 | GSE197262 | GEO

Discovering aptamers by cell-SELEX against human soluble growth factors ectopically expressed on yeast cell surface.

Project description:SELEX, the process of selecting aptamers, is often hampered by the difficulty of preparing target molecules in their native forms and by a lack of a simple yet quantitative assay for monitoring enrichment and affinity of reactive aptamers. In this study, we sought to discover DNA aptamers against human serum markers for potential therapeutic and diagnostic applications. To circumvent soluble expression and immobilization for performing SELEX, we ectopically expressed soluble growth factors on the surface of yeast cells to enable cell-SELEX and devised a flow cytometry-based method to quantitatively monitor progressive enrichment of specific aptamers. High-throughput sequencing of selected pools revealed that the emergence of highly enriched sequences concurred with the increase in the percentage of reactive aptamers shown by flow cytometry. Particularly, selected DNA aptamers against VEGF were specific and of high affinity (K(D) = ∼ 1 nM) and demonstrated a potent inhibition of capillary tube formation of endothelial cells, comparable to the effect of a clinically approved anti-VEGF antibody drug, bevacizumab. Considering the fact that many mammalian secretory proteins have been functionally expressed in yeast, the strategy of implementing cell-SELEX and quantitative binding assay can be extended to discover aptamers against a broad array of soluble antigens.

| S-EPMC3968096 | biostudies-literature

Identification of malaria parasite-infected red blood cell surface aptamers by inertial microfluidic SELEX (I-SELEX).

Project description:Plasmodium falciparum malaria parasites invade and remodel human red blood cells (RBCs) by trafficking parasite-synthesized proteins to the RBC surface. While these proteins mediate interactions with host cells that contribute to disease pathogenesis, the infected RBC surface proteome remains poorly characterized. Here we use a novel strategy (I-SELEX) to discover high affinity aptamers that selectively recognize distinct epitopes uniquely present on parasite-infected RBCs. Based on inertial focusing in spiral microfluidic channels, I-SELEX enables stringent partitioning of cells (efficiency ≥ 10(6)) from unbound oligonucleotides at high volume throughput (~2 × 10(6) cells min(-1)). Using an RBC model displaying a single, non-native antigen and live malaria parasite-infected RBCs as targets, we establish suitability of this strategy for de novo aptamer selections. We demonstrate recovery of a diverse set of aptamers that recognize distinct, surface-displayed epitopes on parasite-infected RBCs with nanomolar affinity, including an aptamer against the protein responsible for placental sequestration, var2CSA. These findings validate I-SELEX as a broadly applicable aptamer discovery platform that enables identification of new reagents for mapping the parasite-infected RBC surface proteome at higher molecular resolution to potentially contribute to malaria diagnostics, therapeutics and vaccine efforts.

| S-EPMC4486934 | biostudies-literature

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

RAPID-SELEX for RNA aptamers.

Project description:Aptamers are high-affinity ligands selected from DNA or RNA libraries via SELEX, a repetitive in vitro process of sequential selection and amplification steps. RNA SELEX is more complicated than DNA SELEX because of the additional transcription and reverse transcription steps. Here, we report a new selection scheme, RAPID-SELEX (RNA Aptamer Isolation via Dual-cycles SELEX), that simplifies this process by systematically skipping unnecessary amplification steps. Using affinity microcolumns, we were able to complete a multiplex selection for protein targets, CHK2 and UBLCP1, in a third of the time required for analogous selections using a conventional SELEX approach. High-throughput sequencing of the enriched pools from both RAPID and SELEX revealed many identical candidate aptamers from the starting pool of 5 × 10(15) sequences. For CHK2, the same sequence was preferentially enriched in both selections as the top candidate and was found to bind to its respective target. These results demonstrate the efficiency and, most importantly, the robustness of our selection scheme. RAPID provides a generalized approach that can be used with any selection technology to accelerate the rate of aptamer discovery, without compromising selection performance.

| S-EPMC3869713 | biostudies-literature

Differential binding cell-SELEX method to identify cell-specific aptamers using high-throughput sequencing.

Project description:Aptamers have in recent years emerged as a viable alternative to antibodies. High-throughput sequencing (HTS) has revolutionized aptamer research by increasing the number of reads from a few (using Sanger sequencing) to millions (using an HTS approach). Despite the availability and advantages of HTS compared to Sanger sequencing, there are only 50 aptamer HTS sequencing samples available on public databases. HTS data in aptamer research are primarily used to compare sequence enrichment between subsequent selection cycles. This approach does not take full advantage of HTS because the enrichment of sequences during selection can be due to inefficient negative selection when using live cells. Here, we present a differential binding cell-SELEX (systematic evolution of ligands by exponential enrichment) workflow that adapts the FASTAptamer toolbox and bioinformatics tool edgeR, which are primarily used for functional genomics, to achieve more informative metrics about the selection process. We propose a fast and practical high-throughput aptamer identification method to be used with the cell-SELEX technique to increase the aptamer selection rate against live cells. The feasibility of our approach is demonstrated by performing aptamer selection against a clear cell renal cell carcinoma (ccRCC) RCC-MF cell line using the RC-124 cell line from healthy kidney tissue for negative selection.

| S-EPMC6544647 | biostudies-literature

Ligand-Guided Selection of Target-Specific Aptamers: A Screening Technology for Identifying Specific Aptamers Against Cell-Surface Proteins.

Project description:We report on a new strategy for identifying highly specific aptamers against a predetermined epitope of a target. Termed "ligand-guided selection" (LIGS), this method uniquely exploits the selection step, the core of SELEX (Systematic Evolution Exponential enrichment). LIGS uses a naturally occurring stronger and highly specific bivalent binder, an antibody (Ab) interacting with its cognate antigen to outcompete specific aptamers from a partially enriched SELEX pool, as a strategy. We demonstrate the hypothesis of LIGS by utilizing an Ab binding to membrane-bound Immunoglobulin M (mIgM) to selectively elute aptamers that are specific for mIgM from a SELEX pool that is partially enriched toward mIgM expressing Ramos cells. The selected aptamers show specificity toward Ramos cells. We identified three aptamer candidates utilizing LIGS that could be outcompeted by mIgM Ab, demonstrating that LIGS can be successfully applied to select aptamers from a partially evolved cell-SELEX library, against predetermined receptor proteins using a cognate ligand. This proof-of-concept study introduces a new biochemical-screening platform that exploits the binding of a secondary stronger molecular entity to its target as a partition step, to identify highly specific artificial nucleic acid ligands.

| S-EPMC4900185 | biostudies-literature

DNA aptamers from whole-serum SELEX as new diagnostic agents against gastric cancer.

Project description:Gastric cancer is still among the leading causes of cancer deaths worldwide. Despite the improvements in diagnostic methods, the status of early detection has not been achieved so far. Early diagnosis of gastric cancer may significantly improve the cure rate of patients. Therefore, a new diagnostic method is needed. In this study, subtractive SELEX was performed to screen gastric cancer serum-specific DNA aptamers by using gastric cancer serum and normal serum as the target and negative serum, respectively. Four highly specific aptamers generated for gastric cancer serum, Seq-3, Seq-6, Seq-19 and Seq-54, were developed using whole-serum subtractive SELEX technology with K d of 128 ± 26.3 nM, 149 ± 23.6 nM, 232 ± 44.2 nM, 202 ± 25.6 nM, respectively. These generated aptamers showed higher specificities toward their target serum by differentiating normal serum but closely related other cancer serums. The selected four high affinity DNA aptamers were further applied to the development based on qPCR method for the early detection of gastric cancer. In addition, we performed MALDI-TOF MS followed by secondary peptide sequencing MS analysis for the identification of the aptamer binding proteins. Among these potential biomarkers, APOA1, APOA4, PARD3, Importin subunit alpha-1 showed a relatively high score probability. Therefore, these four ssDNA aptamers generated in our study could be a promising molecular probe for gastric cancer diagnosis.

| S-EPMC9059574 | biostudies-literature

Capillary electrophoresis-SELEX selection of catalytic DNA aptamers for a small-molecule porphyrin target.

Project description:Capillary electrophoresis-systematic evolution of ligands by exponential enrichment (CE-SELEX) has previously been used to select aptamers for large-molecule targets such as proteins, lipopolysaccharides, and peptides. For the first time, we have performed CE-SELEX selection for a small-molecule target, N-methyl mesoporphyrin (NMM), with a molecular weight of only 580 g/mol. DNA aptamers with high-nanomolar to low-micromolar dissociation constants were achieved after only three rounds of selection. This corresponds to an >50-fold improvement in affinity over the random library. Two out of eight randomly chosen aptamers were found to catalyze the metal insertion reaction of mesoporphyrin with 1.7- and 2.0-fold rate enhancements, respectively.

| S-EPMC3568998 | biostudies-literature

Target-switch SELEX: Screening with alternating targets to generate aptamers to conserved terminal dipeptides.

Project description:Systematic evolution of ligands by exponential enrichment (SELEX) encompasses a wide variety of high-throughput screening techniques for producing nucleic acid binders to molecular targets through directed evolution. We describe here the design and selection steps for discovery of DNA aptamers with specificity for the two consecutive N-terminal amino acids (AAs) of a small peptide (8-10 amino acids). This bead-based method may be adapted for applications requiring binders which recognize a specific portion of the desired target. For complete details on the use and execution of this protocol, please refer to Hong et al. (2022).

| S-EPMC9557731 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data