Browse
Submit Data
Databases
API
Help

Dataset Information

31 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Structure of Slitrk2-PTP? complex reveals mechanisms for splicing-dependent trans-synaptic adhesion.

ABSTRACT: Selective binding between pre- and postsynaptic adhesion molecules can induce synaptic differentiation. Here we report the crystal structure of a synaptogenic trans-synaptic adhesion complex between Slit and Trk-like family member 2 (Slitrk2) and receptor protein tyrosine phosphatase (RPTP) ?. The structure and site-directed mutational analysis revealed the structural basis of splicing-dependent adhesion between Slitrks and type IIa RPTPs for inducing synaptic differentiation.

SUBMITTER: Yamagata A

PROVIDER: S-EPMC4437028 | biostudies-literature | 2015 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Structure of Slitrk2-PTPδ complex reveals mechanisms for splicing-dependent trans-synaptic adhesion.

Yamagata Atsushi A Sato Yusuke Y Goto-Ito Sakurako S Uemura Takeshi T Maeda Asami A Shiroshima Tomoko T Yoshida Tomoyuki T Fukai Shuya S

Scientific reports 20150519

Selective binding between pre- and postsynaptic adhesion molecules can induce synaptic differentiation. Here we report the crystal structure of a synaptogenic trans-synaptic adhesion complex between Slit and Trk-like family member 2 (Slitrk2) and receptor protein tyrosine phosphatase (RPTP) δ. The structure and site-directed mutational analysis revealed the structural basis of splicing-dependent adhesion between Slitrks and type IIa RPTPs for inducing synaptic differentiation. ...[more]

PMID: 25989451

Similar Datasets

Mechanisms of splicing-dependent trans-synaptic adhesion by PTPδ-IL1RAPL1/IL-1RAcP for synaptic differentiation.

Project description:Synapse formation is triggered through trans-synaptic interaction between pairs of pre- and postsynaptic adhesion molecules, the specificity of which depends on splice inserts known as 'splice-insert signaling codes'. Receptor protein tyrosine phosphatase δ (PTPδ) can bidirectionally induce pre- and postsynaptic differentiation of neurons by trans-synaptically binding to interleukin-1 receptor accessory protein (IL-1RAcP) and IL-1RAcP-like-1 (IL1RAPL1) in a splicing-dependent manner. Here, we report crystal structures of PTPδ in complex with IL1RAPL1 and IL-1RAcP. The first immunoglobulin-like (Ig) domain of IL1RAPL1 directly recognizes the first splice insert, which is critical for binding to IL1RAPL1. The second splice insert functions as an adjustable linker that positions the Ig2 and Ig3 domains of PTPδ for simultaneously interacting with the Ig1 domain of IL1RAPL1 or IL-1RAcP. We further identified the IL1RAPL1-specific interaction, which appears coupled to the first-splice-insert-mediated interaction. Our results thus reveal the decoding mechanism of splice-insert signaling codes for synaptic differentiation induced by trans-synaptic adhesion between PTPδ and IL1RAPL1/IL-1RAcP.

| S-EPMC4423211 | biostudies-literature

Splice-dependent trans-synaptic PTPδ-IL1RAPL1 interaction regulates synapse formation and non-REM sleep.

Project description:Alternative splicing regulates trans-synaptic adhesions and synapse development, but supporting in vivo evidence is limited. PTPδ, a receptor tyrosine phosphatase adhering to multiple synaptic adhesion molecules, is associated with various neuropsychiatric disorders; however, its in vivo functions remain unclear. Here, we show that PTPδ is mainly present at excitatory presynaptic sites by endogenous PTPδ tagging. Global PTPδ deletion in mice leads to input-specific decreases in excitatory synapse development and strength. This involves tyrosine dephosphorylation and synaptic loss of IL1RAPL1, a postsynaptic partner of PTPδ requiring the PTPδ-meA splice insert for binding. Importantly, PTPδ-mutant mice lacking the PTPδ-meA insert, and thus lacking the PTPδ interaction with IL1RAPL1 but not other postsynaptic partners, recapitulate biochemical and synaptic phenotypes of global PTPδ-mutant mice. Behaviorally, both global and meA-specific PTPδ-mutant mice display abnormal sleep behavior and non-REM rhythms. Therefore, alternative splicing in PTPδ regulates excitatory synapse development and sleep by modulating a specific trans-synaptic adhesion.

| S-EPMC7265247 | biostudies-literature

Splicing-Dependent Trans-synaptic SALM3-LAR-RPTP Interactions Regulate Excitatory Synapse Development and Locomotion.

Project description:Synaptic adhesion molecules regulate diverse aspects of synapse development and plasticity. SALM3 is a PSD-95-interacting synaptic adhesion molecule known to induce presynaptic differentiation in contacting axons, but little is known about its presynaptic receptors and in vivo functions. Here, we identify an interaction between SALM3 and LAR family receptor protein tyrosine phosphatases (LAR-RPTPs) that requires the mini-exon B splice insert in LAR-RPTPs. In addition, SALM3-dependent presynaptic differentiation requires all three types of LAR-RPTPs. SALM3 mutant (Salm3(-/-)) mice display markedly reduced excitatory synapse number but normal synaptic plasticity in the hippocampal CA1 region. Salm3(-/-) mice exhibit hypoactivity in both novel and familiar environments but perform normally in learning and memory tests administered. These results suggest that SALM3 regulates excitatory synapse development and locomotion behavior.

| S-EPMC4578660 | biostudies-literature

Complex N-glycosylation of mGluR6 is required for trans-synaptic interaction with ELFN adhesion proteins.

Project description:Synaptic transmission from retinal photoreceptors to downstream ON-type bipolar cells (BCs) depends on the postsynaptic metabotropic glutamate receptor mGluR6, located at the BC dendritic tips. Glutamate binding to mGluR6 initiates G-protein signaling that ultimately leads to BC depolarization in response to light. The mGluR6 receptor also engages in trans-synaptic interactions with presynaptic ELFN adhesion proteins. The roles of post-translational modifications in mGluR6 trafficking and function are unknown. Treatment with glycosidase enzymes PNGase F and Endo H demonstrated that both endogenous and heterologously expressed mGluR6 contain complex N-glycosylation acquired in the Golgi. Pull-down experiments with ELFN1 and ELFN2 extracellular domains revealed that these proteins interact exclusively with the complex glycosylated form of mGluR6. Mutation of the four predicted N-glycosylation sites, either singly or in combination, revealed that all four sites are glycosylated. Single mutations partially reduced, but did not abolish, surface expression in heterologous cells, while triple mutants had little or no surface expression, indicating that no single glycosylation site is necessary or sufficient for plasma membrane trafficking. Mutation at N445 severely impaired both ELFN1 and ELFN2 binding. All single mutants exhibited dendritic tip enrichment in rod BCs, as did the triple mutant with N445 as the sole N-glycosylation site, demonstrating that glycosylation at N445 is sufficient but not necessary for dendritic tip localization. The quadruple mutant was completely mislocalized. These results reveal a key role for complex N-glycosylation in regulating mGluR6 trafficking and ELFN binding, and by extension, function of the photoreceptor synapses.

| S-EPMC10973816 | biostudies-literature

Structural basis of SALM5-induced PTPδ dimerization for synaptic differentiation.

Project description:SALM5, a synaptic adhesion molecule implicated in autism, induces presynaptic differentiation through binding to the LAR family receptor protein tyrosine phosphatases (LAR-RPTPs) that have been highlighted as presynaptic hubs for synapse formation. The mechanisms underlying SALM5/LAR-RPTP interaction remain unsolved. Here we report crystal structures of human SALM5 LRR-Ig alone and in complex with human PTPδ Ig1-3 (MeA-). Distinct from other LAR-RPTP ligands, SALM5 mainly exists as a dimer with LRR domains from two protomers packed in an antiparallel fashion. In the 2:2 heterotetrameric SALM5/PTPδ complex, a SALM5 dimer bridges two separate PTPδ molecules. Structure-guided mutations and heterologous synapse formation assays demonstrate that dimerization of SALM5 is prerequisite for its functionality in inducing synaptic differentiation. This study presents a structural template for the SALM family and reveals a mechanism for how a synaptic adhesion molecule directly induces cis-dimerization of LAR-RPTPs into higher-order signaling assembly.

| S-EPMC5773555 | biostudies-literature

Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.

Project description:Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

| S-EPMC3621762 | biostudies-literature

SALM4 suppresses excitatory synapse development by cis-inhibiting trans-synaptic SALM3-LAR adhesion.

Project description:Synaptic adhesion molecules regulate various aspects of synapse development, function and plasticity. These functions mainly involve trans-synaptic interactions and positive regulations, whereas cis-interactions and negative regulation are less understood. Here we report that SALM4, a member of the SALM/Lrfn family of synaptic adhesion molecules, suppresses excitatory synapse development through cis inhibition of SALM3, another SALM family protein with synaptogenic activity. Salm4-mutant (Salm4(-/-)) mice show increased excitatory synapse numbers in the hippocampus. SALM4 cis-interacts with SALM3, inhibits trans-synaptic SALM3 interaction with presynaptic LAR family receptor tyrosine phosphatases and suppresses SALM3-dependent presynaptic differentiation. Importantly, deletion of Salm3 in Salm4(-/-) mice (Salm3(-/-); Salm4(-/-)) normalizes the increased excitatory synapse number. These results suggest that SALM4 negatively regulates excitatory synapses via cis inhibition of the trans-synaptic SALM3-LAR adhesion.

| S-EPMC4974644 | biostudies-literature

The CaMKII/NMDA receptor complex controls hippocampal synaptic transmission by kinase-dependent and independent mechanisms.

Project description:CaMKII is one of the most studied synaptic proteins, but many critical issues regarding its role in synaptic function remain unresolved. Using a CRISPR-based system to delete CaMKII and replace it with mutated forms in single neurons, we have rigorously addressed its various synaptic roles. In brief, basal AMPAR and NMDAR synaptic transmission both require CaMKII?, but not CaMKII?, indicating that, even in the adult, synaptic transmission is determined by the ongoing action of CaMKII?. While AMPAR transmission requires kinase activity, NMDAR transmission does not, implying a scaffolding role for the CaMKII protein instead. LTP is abolished in the absence of CaMKII? and/or CaMKII? and with an autophosphorylation impaired CaMKII? (T286A). With the exception of NMDAR synaptic currents, all aspects of CaMKII? signaling examined require binding to the NMDAR, emphasizing the essential role of this receptor as a master synaptic signaling hub.

| S-EPMC5970233 | biostudies-literature

Trans-cellular regulation of synaptic properties by neuron-specific alternative splicing

Project description:Genome-wide mapping of ribosome-associated mRNAs to investigate cell type-specific loss of function of the nuclear RNA binding protein SLM2 in the mouse hippocampus

2022-07-30 | GSE209870 | GEO

NELL2-Robo3 complex structure reveals mechanisms of receptor activation for axon guidance.

Project description:Axon pathfinding is critical for nervous system development, and it is orchestrated by molecular cues that activate receptors on the axonal growth cone. Robo family receptors bind Slit guidance cues to mediate axon repulsion. In mammals, the divergent family member Robo3 does not bind Slits, but instead signals axon repulsion from its own ligand, NELL2. Conversely, canonical Robos do not mediate NELL2 signaling. Here, we present the structures of NELL-Robo3 complexes, identifying a mode of ligand engagement for Robos that is orthogonal to Slit binding. We elucidate the structural basis for differential binding between NELL and Robo family members and show that NELL2 repulsive activity is a function of its Robo3 affinity and is enhanced by ligand trimerization. Our results reveal a mechanism of oligomerization-induced Robo activation for axon guidance and shed light on Robo family member ligand binding specificity, conformational variability, divergent modes of signaling, and evolution.

| S-EPMC7083938 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data