Browse
Submit Data
Databases
API
Help

Dataset Information

27 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Structure of Slitrk2-PTP? complex reveals mechanisms for splicing-dependent trans-synaptic adhesion.

ABSTRACT: Selective binding between pre- and postsynaptic adhesion molecules can induce synaptic differentiation. Here we report the crystal structure of a synaptogenic trans-synaptic adhesion complex between Slit and Trk-like family member 2 (Slitrk2) and receptor protein tyrosine phosphatase (RPTP) ?. The structure and site-directed mutational analysis revealed the structural basis of splicing-dependent adhesion between Slitrks and type IIa RPTPs for inducing synaptic differentiation.

SUBMITTER: Yamagata A

PROVIDER: S-EPMC4437028 | biostudies-literature | 2015 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Structure of Slitrk2-PTPδ complex reveals mechanisms for splicing-dependent trans-synaptic adhesion.

Yamagata Atsushi A Sato Yusuke Y Goto-Ito Sakurako S Uemura Takeshi T Maeda Asami A Shiroshima Tomoko T Yoshida Tomoyuki T Fukai Shuya S

Scientific reports 20150519

Selective binding between pre- and postsynaptic adhesion molecules can induce synaptic differentiation. Here we report the crystal structure of a synaptogenic trans-synaptic adhesion complex between Slit and Trk-like family member 2 (Slitrk2) and receptor protein tyrosine phosphatase (RPTP) δ. The structure and site-directed mutational analysis revealed the structural basis of splicing-dependent adhesion between Slitrks and type IIa RPTPs for inducing synaptic differentiation. ...[more]

PMID: 25989451

Similar Datasets

Mechanisms of splicing-dependent trans-synaptic adhesion by PTP?-IL1RAPL1/IL-1RAcP for synaptic differentiation.

Project description:Synapse formation is triggered through trans-synaptic interaction between pairs of pre- and postsynaptic adhesion molecules, the specificity of which depends on splice inserts known as 'splice-insert signaling codes'. Receptor protein tyrosine phosphatase ? (PTP?) can bidirectionally induce pre- and postsynaptic differentiation of neurons by trans-synaptically binding to interleukin-1 receptor accessory protein (IL-1RAcP) and IL-1RAcP-like-1 (IL1RAPL1) in a splicing-dependent manner. Here, we report crystal structures of PTP? in complex with IL1RAPL1 and IL-1RAcP. The first immunoglobulin-like (Ig) domain of IL1RAPL1 directly recognizes the first splice insert, which is critical for binding to IL1RAPL1. The second splice insert functions as an adjustable linker that positions the Ig2 and Ig3 domains of PTP? for simultaneously interacting with the Ig1 domain of IL1RAPL1 or IL-1RAcP. We further identified the IL1RAPL1-specific interaction, which appears coupled to the first-splice-insert-mediated interaction. Our results thus reveal the decoding mechanism of splice-insert signaling codes for synaptic differentiation induced by trans-synaptic adhesion between PTP? and IL1RAPL1/IL-1RAcP.

| S-EPMC4423211 | biostudies-literature

Splice-dependent trans-synaptic PTP?-IL1RAPL1 interaction regulates synapse formation and non-REM sleep

Project description:Alternative splicing regulates trans-synaptic adhesions and synapse development, but supporting in vivo evidence is limited. PTP?, a receptor tyrosine phosphatase adhering to multiple synaptic adhesion molecules, is associated with various neuropsychiatric disorders; however, its in vivo functions remain unclear. Here we show that PTP? is mainly present at excitatory presynaptic sites by endogenous PTP? tagging. Global PTP? deletion in mice leads to input-specific decreases in excitatory synapse development and strength. This involves tyrosine dephosphorylation and synaptic loss of IL1RAPL1, a postsynaptic partner of PTP? requiring the PTP?-meA splice insert for binding. Importantly, PTP?-mutant mice lacking the PTP?-meA insert, and thus lacking the PTP??interaction with IL1RAPL1 but not other postsynaptic partners, recapitulate biochemical and synaptic phenotypes of global PTP?-mutant mice. Behaviorally, both global and meA-specific PTP?-mutant mice display abnormal sleep behavior and non-REM rhythms. Therefore, alternative splicing in PTP? regulates excitatory synapse development and sleep by modulating a specific trans-synaptic adhesion.

| S-SCDT-EMBOJ-2019-104150 | biostudies-other

Selective control of inhibitory synapse development by Slitrk3-PTP? trans-synaptic interaction.

Project description:Balanced development of excitatory and inhibitory synapses is required for normal brain function, and an imbalance in this development may underlie the pathogenesis of many neuropsychiatric disorders. Compared with the many identified trans-synaptic adhesion complexes that organize excitatory synapses, little is known about the organizers that are specific for inhibitory synapses. We found that Slit and NTRK-like family member 3 (Slitrk3) actS as a postsynaptic adhesion molecule that selectively regulates inhibitory synapse development via trans-interaction with axonal tyrosine phosphatase receptor PTP?. When expressed in fibroblasts, Slitrk3 triggered only inhibitory presynaptic differentiation in contacting axons of co-cultured rat hippocampal neurons. Recombinant Slitrk3 preferentially localized to inhibitory postsynaptic sites. Slitrk3-deficient mice exhibited decreases in inhibitory, but not excitatory, synapse number and function in hippocampal CA1 neurons and exhibited increased seizure susceptibility and spontaneous epileptiform activity. Slitrk3 required trans-interaction with axonal PTP? to induce inhibitory presynaptic differentiation. These results identify Slitrk3-PTP? as an inhibitory-specific trans-synaptic organizing complex that is required for normal functional GABAergic synapse development.

| S-EPMC3288805 | biostudies-literature

Splicing-Dependent Trans-synaptic SALM3-LAR-RPTP Interactions Regulate Excitatory Synapse Development and Locomotion.

Project description:Synaptic adhesion molecules regulate diverse aspects of synapse development and plasticity. SALM3 is a PSD-95-interacting synaptic adhesion molecule known to induce presynaptic differentiation in contacting axons, but little is known about its presynaptic receptors and in vivo functions. Here, we identify an interaction between SALM3 and LAR family receptor protein tyrosine phosphatases (LAR-RPTPs) that requires the mini-exon B splice insert in LAR-RPTPs. In addition, SALM3-dependent presynaptic differentiation requires all three types of LAR-RPTPs. SALM3 mutant (Salm3(-/-)) mice display markedly reduced excitatory synapse number but normal synaptic plasticity in the hippocampal CA1 region. Salm3(-/-) mice exhibit hypoactivity in both novel and familiar environments but perform normally in learning and memory tests administered. These results suggest that SALM3 regulates excitatory synapse development and locomotion behavior.

| S-EPMC4578660 | biostudies-literature

Structural basis of trans-synaptic interactions between PTP? and SALMs for inducing synapse formation.

Project description:Synapse formation is triggered by trans-synaptic interactions of cell adhesion molecules, termed synaptic organizers. Three members of type-II receptor protein tyrosine phosphatases (classified as type-IIa RPTPs; PTP?, PTP? and LAR) are known as presynaptic organizers. Synaptic adhesion-like molecules (SALMs) have recently emerged as a family of postsynaptic organizers. Although all five SALM isoforms can bind to the type-IIa RPTPs, only SALM3 and SALM5 reportedly have synaptogenic activities depending on their binding. Here, we report the crystal structures of apo-SALM5, and PTP?-SALM2 and PTP?-SALM5 complexes. The leucine-rich repeat (LRR) domains of SALMs interact with the second immunoglobulin-like (Ig) domain of PTP?, whereas the Ig domains of SALMs interact with both the second and third Ig domains of PTP?. Unexpectedly, the structures exhibit the LRR-mediated 2:2 complex. Our synaptogenic co-culture assay using site-directed SALM5 mutants demonstrates that presynaptic differentiation induced by PTP?-SALM5 requires the dimeric property of SALM5.

| S-EPMC5773591 | biostudies-literature

Presynaptic PTP? regulates postsynaptic NMDA receptor function through direct adhesion-independent mechanisms.

Project description:Synaptic adhesion molecules regulate synapse development and function. However, whether and how presynaptic adhesion molecules regulate postsynaptic NMDAR function remains largely unclear. Presynaptic LAR family receptor tyrosine phosphatases (LAR-RPTPs) regulate synapse development through mechanisms that include trans-synaptic adhesion; however, whether they regulate postsynaptic receptor functions remains unknown. Here we report that presynaptic PTP?, a LAR-RPTP, enhances postsynaptic NMDA receptor (NMDAR) currents and NMDAR-dependent synaptic plasticity in the hippocampus. This regulation does not involve trans-synaptic adhesions of PTP?, suggesting that the cytoplasmic domains of PTP?, known to have tyrosine phosphatase activity and mediate protein-protein interactions, are important. In line with this, phosphotyrosine levels of presynaptic proteins, including neurexin-1, are strongly increased in PTP?-mutant mice. Behaviorally, PTP?-dependent NMDAR regulation is important for social and reward-related novelty recognition. These results suggest that presynaptic PTP? regulates postsynaptic NMDAR function through trans-synaptic and direct adhesion-independent mechanisms and novelty recognition in social and reward contexts.

| S-EPMC7069723 | biostudies-literature

Postsynaptic TrkC and presynaptic PTP? function as a bidirectional excitatory synaptic organizing complex.

Project description:Neurotrophin receptor tyrosine kinases (Trks) have well-defined trophic roles in nervous system development through kinase activation by neurotrophins. Yet Trks have typical cell-adhesion domains and express noncatalytic isoforms, suggesting additional functions. Here we discovered noncatalytic TrkC in an unbiased hippocampal neuron-fibroblast coculture screen for proteins that trigger differentiation of neurotransmitter release sites in axons. All TrkC isoforms, but not TrkA or TrkB, function directly in excitatory glutamatergic synaptic adhesion by neurotrophin-independent high-affinity trans binding to axonal protein tyrosine phosphatase receptor PTP?. PTP? triggers and TrkC mediates clustering of postsynaptic molecules in dendrites, indicating bidirectional synaptic organizing functions. Effects of a TrkC-neutralizing antibody that blocks TrkC-PTP? interaction and TrkC knockdown in culture and in vivo reveal essential roles of TrkC-PTP? in glutamatergic synapse formation. Thus, postsynaptic TrkC trans interaction with presynaptic PTP? generates bidirectional adhesion and recruitment essential for excitatory synapse development and positions these signaling molecules at the center of synaptic pathways.

| S-EPMC3056349 | biostudies-literature

Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.

Project description:Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

| S-EPMC3621762 | biostudies-literature

SALM4 suppresses excitatory synapse development by cis-inhibiting trans-synaptic SALM3-LAR adhesion.

Project description:Synaptic adhesion molecules regulate various aspects of synapse development, function and plasticity. These functions mainly involve trans-synaptic interactions and positive regulations, whereas cis-interactions and negative regulation are less understood. Here we report that SALM4, a member of the SALM/Lrfn family of synaptic adhesion molecules, suppresses excitatory synapse development through cis inhibition of SALM3, another SALM family protein with synaptogenic activity. Salm4-mutant (Salm4(-/-)) mice show increased excitatory synapse numbers in the hippocampus. SALM4 cis-interacts with SALM3, inhibits trans-synaptic SALM3 interaction with presynaptic LAR family receptor tyrosine phosphatases and suppresses SALM3-dependent presynaptic differentiation. Importantly, deletion of Salm3 in Salm4(-/-) mice (Salm3(-/-); Salm4(-/-)) normalizes the increased excitatory synapse number. These results suggest that SALM4 negatively regulates excitatory synapses via cis inhibition of the trans-synaptic SALM3-LAR adhesion.

| S-EPMC4974644 | biostudies-literature

The CaMKII/NMDA receptor complex controls hippocampal synaptic transmission by kinase-dependent and independent mechanisms.

Project description:CaMKII is one of the most studied synaptic proteins, but many critical issues regarding its role in synaptic function remain unresolved. Using a CRISPR-based system to delete CaMKII and replace it with mutated forms in single neurons, we have rigorously addressed its various synaptic roles. In brief, basal AMPAR and NMDAR synaptic transmission both require CaMKII?, but not CaMKII?, indicating that, even in the adult, synaptic transmission is determined by the ongoing action of CaMKII?. While AMPAR transmission requires kinase activity, NMDAR transmission does not, implying a scaffolding role for the CaMKII protein instead. LTP is abolished in the absence of CaMKII? and/or CaMKII? and with an autophosphorylation impaired CaMKII? (T286A). With the exception of NMDAR synaptic currents, all aspects of CaMKII? signaling examined require binding to the NMDAR, emphasizing the essential role of this receptor as a master synaptic signaling hub.

| S-EPMC5970233 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data