Dataset Information

Hypouricaemia and hyperuricosuria in familial renal glucosuria.

ABSTRACT: Familial renal glucosuria is a rare co-dominantly inherited benign phenotype characterized by the presence of glucose in the urine. It is caused by mutations in the SLC5A2 gene that encodes SGLT2, the Na(+)-glucose cotransporter responsible for the reabsorption of the bulk of glucose in the proximal tubule. We report a case of FRG displaying both severe glucosuria and renal hypouricaemia. We hypothesize that glucosuria can disrupt urate reabsorption in the proximal tubule, directly causing hyperuricosuria.

SUBMITTER: Aires I

PROVIDER: S-EPMC4438413 | biostudies-literature | 2013 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Hypouricaemia and hyperuricosuria in familial renal glucosuria.

Aires Inês I Santos Ana Rita AR Pratas Jorge J Nolasco Fernando F Calado Joaquim J

Clinical kidney journal 20131001 5

Familial renal glucosuria is a rare co-dominantly inherited benign phenotype characterized by the presence of glucose in the urine. It is caused by mutations in the SLC5A2 gene that encodes SGLT2, the Na(+)-glucose cotransporter responsible for the reabsorption of the bulk of glucose in the proximal tubule. We report a case of FRG displaying both severe glucosuria and renal hypouricaemia. We hypothesize that glucosuria can disrupt urate reabsorption in the proximal tubule, directly causing hyper ...[more]

PMID: 26064518

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Hypouricaemia and hyperuricosuria in familial renal glucosuria.

Publications

Hypouricaemia and hyperuricosuria in familial renal glucosuria.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure