Dataset Information

A recurrent deletion in the SLC5A2 gene including the intron 7 branch site responsible for familial renal glucosuria.

ABSTRACT: Familial renal glycosuria (FRG) is caused by mutations in the SLC5A2 gene, which codes for Na(+)-glucose co-transporters 2 (SGLT2). The aim of this study was to analyze and identify the mutations in 16 patients from 8 families with FRG. All coding regions, including intron-exon boundaries, were analyzed using PCR followed by direct sequence analysis. Six mutations in SLC5A2 gene were identified, including five missense mutations (c.393G?>?C, p.K131N; c.1003A?>?G, p.S335G; c.1343A?>?G, p.Q448R; c.1420G?>?C, p.A474P; c.1739G?>?A, p.G580D) and a 22-bp deletion in intron 7 (c.886(-10_-31)del) removing the putative branch point sequence. By the minigene studies using the pSPL3 plasmids, we confirmed that the deletion c.886(-10_-31)del acts as a splicing mutation. Furthermore, we found that this deletion causes exclusion of exon 8 in the SCL5A2 transcript in patients. The mutation c.886(-10_-31)del was present in 5 (62.5%) of 8 families, and accounts for about 37.5% of the total alleles (6/16). In conclusion, six mutations resulting in FRG were found, and the c.886(-10_-31)del may be the high frequency mutation that can be screened in FRG patients with uniallelic or negative SLC5A2 mutations.

SUBMITTER: Zhao X

PROVIDER: S-EPMC5036194 | biostudies-literature | 2016 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A recurrent deletion in the SLC5A2 gene including the intron 7 branch site responsible for familial renal glucosuria.

Zhao Xiangzhong X Cui Li L Lang Yanhua Y Liu Ting T Lu Jingru J Wang Cui C Tuffery-Giraud Sylvie S Bottillo Irene I Wang Xinsheng X Shao Leping L

Scientific reports 20160926

Familial renal glycosuria (FRG) is caused by mutations in the SLC5A2 gene, which codes for Na<sup>+</sup>-glucose co-transporters 2 (SGLT2). The aim of this study was to analyze and identify the mutations in 16 patients from 8 families with FRG. All coding regions, including intron-exon boundaries, were analyzed using PCR followed by direct sequence analysis. Six mutations in SLC5A2 gene were identified, including five missense mutations (c.393G > C, p.K131N; c.1003A > G, p.S335G; c.1343A > G, p ...[more]

PMID: 27666404

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

A recurrent deletion in the SLC5A2 gene including the intron 7 branch site responsible for familial renal glucosuria.

Publications

A recurrent deletion in the SLC5A2 gene including the intron 7 branch site responsible for familial renal glucosuria.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets