Dataset Information

A novel compound heterozygous mutation in SLC5A2 contributes to familial renal glucosuria in a Chinese family, and a review of the relevant literature.

ABSTRACT: Familial renal glucosuria (FRG) is a rare condition that involves isolated glucosuria despite normal blood glucose levels. Mutations in the solute carrier family 5 member 2 (SLC5A2) gene, which encodes sodium?glucose cotransporter 2 (SGLT2), have been reported to be responsible for the disease. Genetic testing of the SLC5A2 gene was conducted in a Chinese family with FRG. A number of online tools were used to predict the potential effect of the identified mutations on SGLT2 function. Additionally, the SLC5A2 mutations previously reported in PubMed were summarized. A novel compound heterozygous mutation (c.514T>C, p.W172R; c.1540C>T, p.P514S) of the SLC5A2 gene in a Chinese child with FRG was identified. In total, 86 mutations of the SLC5A2 gene have been reported to be associated with FRG. The novel compound heterozygous mutation (c.514T>C, p.W172R; c.1540C>T, p.P514S) of the SLC5A2 gene may be responsible for the onset of FRG. The present study provides a starting point for further investigation of the molecular pathogenesis of the SLC5A2 gene mutation in patients with FRG.

SUBMITTER: Li S

PROVIDER: S-EPMC6472135 | biostudies-literature | 2019 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A novel compound heterozygous mutation in SLC5A2 contributes to familial renal glucosuria in a Chinese family, and a review of the relevant literature.

Li Shentang S Yang Yeyi Y Huang Lihua L Kong Min M Yang Zuocheng Z

Molecular medicine reports 20190401 5

Familial renal glucosuria (FRG) is a rare condition that involves isolated glucosuria despite normal blood glucose levels. Mutations in the solute carrier family 5 member 2 (SLC5A2) gene, which encodes sodium‑glucose cotransporter 2 (SGLT2), have been reported to be responsible for the disease. Genetic testing of the SLC5A2 gene was conducted in a Chinese family with FRG. A number of online tools were used to predict the potential effect of the identified mutations on SGLT2 function. Additionall ...[more]

PMID: 30942416

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Project description:BackgroundRenal hypouricemia (RHUC) is a heterogeneous genetic disorder that is characterized by decreased serum uric acid concentration and increased fractional excretion of uric acid. Previous reports have revealed many functional mutations in two urate transporter genes, SLC22A12 and/or SLC2A9, to be the causative genetic factors of this disorder. However, there are still unresolved patients, suggesting the existence of other causal genes or new mutations. Here, we report an RHUC patient with novel compound heterozygous mutations in the SLC22A12 gene.Case presentationA 27-year-old female presenting with recurrent hypouricemia during routine checkups was referred to our hospital. After obtaining the patient's consent, both the patient and her healthy parents were analyzed using whole-exome sequencing (WES) and Sanger sequencing to discover and validate causal mutations, respectively. The prioritization protocol of WES screened out two mutations of c.269G?>?A/p.R90H and c.1289_1290insGG/p.M430fsX466, which are both located in the SLC22A12 gene, in the patient. Sanger sequencing further confirmed that the patient's heterozygous c.269G?>?A/p.R90H mutation, which has been reported previously, derived from her mother, and the heterozygous c.1289_1290insGG/p.M430fsX466 mutation, which was found for the first time, derived from her father. p.R90H, which is highly conserved among different species, may decrease the stability of this domain and was considered to be almost damaging in silicon analysis. p.M430fsX466 lacks the last three transmembrane domains, including the tripeptide motif (S/T)X? (X?=?any amino acid and ??=?hydrophobic residue), at the C-terminal, which interact with scaffolding protein PDZK1 and thus will possibly lead to weak functioning of urate transport through the disruption of the "transporter complex" that is formed by URAT1 and PDZK1.ConclusionsWe report a Chinese patient with RHUC, which was caused by compound heterozygous mutations of the SLC22A12 gene, using WES and Sanger sequencing for the first time. Mutation-induced structural instability or malfunction of the urate transporter complex may be the main mechanisms for this hereditary disorder.

Dataset Information

A novel compound heterozygous mutation in SLC5A2 contributes to familial renal glucosuria in a Chinese family, and a review of the relevant literature.

Publications

A novel compound heterozygous mutation in SLC5A2 contributes to familial renal glucosuria in a Chinese family, and a review of the relevant literature.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets