Dataset Information

Clinical and genetic analysis in a patient with primary renal glucosuria: Identification of a novel mutation in the SLC5A2 gene.

ABSTRACT: Primary renal glucosuria (PRG; OMIM #233100) is characterized by persistent glucosuria due to a reduction in the renal tubular reabsorption of glucose in the presence of a normal concentration of serum glucose and the absence of any other impairment of tubular function. The SLC5A2 gene is the causative gene, which codes for the low-affinity sodium/glucose co-transporter SGLT2. In the present study, the case of a patient with PRG associated with a novel mutation of the SLC5A2 gene is reported. The patient visited hospital for the evaluation of glucosuria in the absence of hyperglycemia, a condition that had been present for >20 years. The patient showed a fasting blood sugar level of 104 mg/dl, a 2-h postprandial sugar level of 101 mg/dl, a sodium level of 144 mmol/l, a potassium level of 3.7 mmol/l and a chloride level of 106 mmol/l in serum. Urine chemistry revealed that the amount of glucose excreted was 10.8 g/1.73 m2/24 h; however, the levels of the other parameters were unremarkable. Polymerase chain reaction (PCR) sequencing analysis of the SLC5A2 gene from the patient revealed a novel 1 bp deletion mutation, which altered the coding sequence of exon 10 in the transmembrane domain (c.1162delG; Ala388ProfsX48), suggesting an autosomal dominant inheritance pattern. This study identified a novel mutation in the SLC5A2 gene related to a benign clinical characteristic and suggests that the molecular diagnosis of the SLC5A2 gene may be useful for diagnosing renal glucosuria in patients and for deciding intervention measures for their family members.

SUBMITTER: Lee YW

PROVIDER: S-EPMC3829744 | biostudies-literature | 2013 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Clinical and genetic analysis in a patient with primary renal glucosuria: Identification of a novel mutation in the SLC5A2 gene.

Lee Yong-Wha YW

Experimental and therapeutic medicine 20131004 6

Primary renal glucosuria (PRG; OMIM #233100) is characterized by persistent glucosuria due to a reduction in the renal tubular reabsorption of glucose in the presence of a normal concentration of serum glucose and the absence of any other impairment of tubular function. The SLC5A2 gene is the causative gene, which codes for the low-affinity sodium/glucose co-transporter SGLT2. In the present study, the case of a patient with PRG associated with a novel mutation of the SLC5A2 gene i ...[more]

PMID: 24255686

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Clinical and genetic analysis in a patient with primary renal glucosuria: Identification of a novel mutation in the SLC5A2 gene.

Publications

Clinical and genetic analysis in a patient with primary renal glucosuria: Identification of a novel mutation in the <i>SLC5A2</i> gene.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure