Dataset Information

Genetic variation in leptin and leptin receptor genes is a risk factor for idiopathic recurrent spontaneous abortion.

ABSTRACT: AIM:To determine whether maternal leptin (LEP) and leptin receptor (LEPR) gene polymorphisms are associated with idiopathic recurrent spontaneous abortion (IRSA). METHODS:This case-control association study conducted from 2010 to 2012 at the Department of Gynecology and Obstetrics, University Hospital Center Osijek and Clinical Institute of Medical Genetics Ljubljana included 178 women with a history of three or more IRSAs before the 22nd week of gestation and 145 women with at least two live births and no history of pathologic pregnancies during reproductive period. Polymorphisms of maternal LEP (rs7799039, rs2122627, rs11761556, rs10244329) and LEPR (rs1137101, rs7516341, rs1186403, rs12062820) were assessed by allele specific real-time polymerase chain reaction. Genotype distribution, allele frequencies, and frequency of haplotypes at LEP and LEPR genetic loci were determined. RESULTS:We observed more frequent genotype for rs7516341 (nominal P=0.034, odds ratio [OR] 0.61, 95% confidence interval [CI] 0.38-0.97) and rs1137101 (nominal P=0.048, OR 1.66, 95% CI 1.00-2.80) in the LEPR gene in patients than in controls, but these results did not remain significant after correction for multiple testing according to Bonferroni (adjusted P value threshold was set at 0.05). We did not observe differential distribution of genotype frequencies in the LEP gene between cases and controls. In patients with IRSA, GTCC haplotype in the LEPR gene locus was significantly less frequent than in controls (PP=0.00865, OR 0.45), contrary to ACTC haplotype (PP=0.0087, OR 1.98). CONCLUSIONS:We showed that genetic variability in the LEPR gene was associated with IRSA, warranting confirmation on a greater number of patients and pathogenesis investigation.

SUBMITTER: Muller A

PROVIDER: S-EPMC5209929 | biostudies-literature | 2016 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Genetic variation in leptin and leptin receptor genes is a risk factor for idiopathic recurrent spontaneous abortion.

Müller Andrijana A Wagner Jasenka J Hodžić Alenka A Maver Aleš A Škrlec Ivana I Heffer Marija M Zibar Lada L Peterlin Borut B

Croatian medical journal 20161201 6

<h4>Aim</h4>To determine whether maternal leptin (LEP) and leptin receptor (LEPR) gene polymorphisms are associated with idiopathic recurrent spontaneous abortion (IRSA).<h4>Methods</h4>This case-control association study conducted from 2010 to 2012 at the Department of Gynecology and Obstetrics, University Hospital Center Osijek and Clinical Institute of Medical Genetics Ljubljana included 178 women with a history of three or more IRSAs before the 22nd week of gestation and 145 women with at le ...[more]

PMID: 28051281

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Genetic variation in leptin and leptin receptor genes is a risk factor for idiopathic recurrent spontaneous abortion.

Publications

Genetic variation in leptin and leptin receptor genes is a risk factor for idiopathic recurrent spontaneous abortion.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets