Dataset Information

Association of Estrogen Receptor 1 Genetic Polymorphisms with Recurrent Spontaneous Abortion Risk.

ABSTRACT: Background:Estrogen is one of the most important reproductive steroidal hormones and plays a critical role in the maintenance of pregnancy, and its function is mediated by estrogen receptor 1(ESR1). The polymorphisms of ESR1 were involved in recurrent spontaneous abortion (RSA); however, the association between ESR1 polymorphisms and RSA remains controversial. The present meta-analysis was aimed to clarify the association between ESR1 PvuII (-397C/T, rs2234693) and XbaI (-351A/G, rs9340799) polymorphisms and the risk of RSA. Methods:All the included articles were retrieved from PubMed, Embase, Cochrane Library, China National Knowledge Infrastructure, and Wanfang Med Online Database up to January 3, 2018. Data were processed in the Stata 12.0 software. The odds ratios (OR s) and 95% confidence intervals (95% CI s) were calculated using fixed-effects models (FEM)/random-effects models (REM). Results:Seven case-control studies with 836 cases and 1164 controls were included in the study. Generally, the ESR1 polymorphisms were not associated with RSA in any of the genetic analysis models. However, it was found that as rs9340799 polymorphism was related to increased risk of RSA in non-Asian group in the homozygous genetic model (OR = 2.40, 95% CI = 1.05-5.50, P = 0.039). Moreover, in Asian group, rs9340799 polymorphism was found to be related to decreased RSA risk in both the heterozygous model (OR = 0.53, 95% CI = 0.33-0.85, P = 0.009) and the dominant genetic model (OR = 0.55, 95% CI = 0.30-0.98, P = 0.042). Conclusions:Generally, there was no significant association between the polymorphisms of ESR1 and the risk of RSA. However, subgroup analysis indicated that ESR1 rs9340799 polymorphism was related to increased RSA risk in the non-Asian group while associated with decreased RSA risk in Asian group.

SUBMITTER: Yin XQ

PROVIDER: S-EPMC6071461 | biostudies-literature | 2018 Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Association of Estrogen Receptor 1 Genetic Polymorphisms with Recurrent Spontaneous Abortion Risk.

Yin Xun-Qiang XQ Ju Hong-Mei HM Guo Qiang Q Zhao Lin L Zhu Xiao-Xiao XX Wei Ran R Zhang Zhen Z Zhang Yun-Hong YH Wang Bin B Li Xia X

Chinese medical journal 20180801 15

<h4>Background</h4>Estrogen is one of the most important reproductive steroidal hormones and plays a critical role in the maintenance of pregnancy, and its function is mediated by estrogen receptor 1(ESR1). The polymorphisms of ESR1 were involved in recurrent spontaneous abortion (RSA); however, the association between ESR1 polymorphisms and RSA remains controversial. The present meta-analysis was aimed to clarify the association between ESR1 PvuII (-397C/T, rs2234693) and XbaI (-351A/G, rs93407 ...[more]

PMID: 30058584

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Association of Estrogen Receptor 1 Genetic Polymorphisms with Recurrent Spontaneous Abortion Risk.

Publications

Association of Estrogen Receptor 1 Genetic Polymorphisms with Recurrent Spontaneous Abortion Risk.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets