Dataset Information

A case report of reversible generalized seizures in a patient with Waardenburg syndrome associated with a novel nonsense mutation in the penultimate exon of SOX10.

ABSTRACT: BACKGROUND:Waardenburg syndrome type 1 (WS1) can be distinguished from Waardenburg syndrome type 2 (WS2) by the presence of dystopia canthorum. About 96% of WS1 are due to PAX3 mutations, and SOX10 mutations have been reported in 15% of WS2. CASE PRESENTATION:This report describes a patient with WS1 who harbored a novel SOX10 nonsense mutation (c.652G?>?T, p.G218*) in exon 3 which is the penultimate exon. The patient had mild prodromal neurological symptoms that were followed by severe attacks of generalized seizures associated with delayed myelination of the brain. The immature myelination recovered later and the neurological symptoms could be improved. This is the first truncating mutation in exon 3 of SOX10 that is associated with neurological symptoms in Waardenburg syndrome. Previous studies reported that the neurological symptoms that associate with WS are congenital and irreversible. These findings suggest that the reversible neurological phenotype may be associated with the nonsense mutation in exon 3 of SOX10. CONCLUSIONS:When patients of WS show mild prodromal neurological symptoms, the clinician should be aware of the possibility that severe attacks of generalized seizures may follow, which may be associated with the truncating mutation in exon 3 of SOX10.

SUBMITTER: Suzuki N

PROVIDER: S-EPMC5966879 | biostudies-literature | 2018 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A case report of reversible generalized seizures in a patient with Waardenburg syndrome associated with a novel nonsense mutation in the penultimate exon of SOX10.

Suzuki Noriomi N Mutai Hideki H Miya Fuyuki F Tsunoda Tatsuhiko T Terashima Hiroshi H Morimoto Noriko N Matsunaga Tatsuo T

BMC pediatrics 20180523 1

<h4>Background</h4>Waardenburg syndrome type 1 (WS1) can be distinguished from Waardenburg syndrome type 2 (WS2) by the presence of dystopia canthorum. About 96% of WS1 are due to PAX3 mutations, and SOX10 mutations have been reported in 15% of WS2.<h4>Case presentation</h4>This report describes a patient with WS1 who harbored a novel SOX10 nonsense mutation (c.652G > T, p.G218*) in exon 3 which is the penultimate exon. The patient had mild prodromal neurological symptoms that were followed by s ...[more]

PMID: 29792164

Similar Datasets

Project description:BackgroundWaardenburg syndrome (WS) is a rare genetic disorder. The purpose of this study was to investigate clinical and molecular characteristics of WS in four probands from four different Iranian families.Case presentationThe first patient was a 1-year-old symptomatic boy with congenital hearing loss and heterochromia iridis with a blue segment in his left iris. The second case was a 1.5-year-old symptomatic girl who manifested congenital profound hearing loss, brilliant blue eyes, and skin hypopigmentation on the abdominal region at birth time. The third patient was an 8-month-old symptomatic boy with developmental delay, mild atrophy, hypotonia, brilliant blue eyes, skin hypopigmentation on her hand and foot, Hirschsprung disease, and congenital profound hearing loss; the fourth patient was a 4-year-old symptomatic boy who showed dystopia canthorum, broad nasal root, synophrys, skin hypopigmentation on her hand and abdomen, brilliant blue eyes, and congenital profound hearing loss. Whole exome sequencing (WES) was used for each proband to identify the underlying genetic factor. Sanger sequencing was performed for validation of the identified mutations in probands and the available family members. A novel heterozygous frameshift mutation, c.996delT (p.K334Sfs*15), on exon 8 of the MITF gene was identified in the patient of the first family diagnosed with WS2A. Two novel de novo heterozygous mutations including a missense mutation, c.950G?>?A (p.R317K), on exon 8 of the MITF gene, and a frameshift mutation, c.684delC (p.E229Sfs*57), on the exon 3 of the SOX10 gene were detected in patients of the second and third families with WS2A and PCWH (Peripheral demyelinating neuropathy, Central dysmyelinating leukodystrophy, Waardenburg syndrome, Hirschsprung disease), respectively. A previously reported heterozygous frameshift mutation, c.1024_1040del AGCACGATTCCTTCCAA, (p.S342Pfs*62), on exon 7 of the PAX3 gene was identified in the patient of the fourth family with WS1.ConclusionsAn exact description of the mutations responsible for WS provides useful information to explain the molecular cause of clinical features of WS and contributes to better genetic counseling of WS patients and their families.

Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30?), c.207_8 delCG (p.Cys71Hisfs?62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs?42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs?117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Dataset Information

A case report of reversible generalized seizures in a patient with Waardenburg syndrome associated with a novel nonsense mutation in the penultimate exon of SOX10.

Publications

A case report of reversible generalized seizures in a patient with Waardenburg syndrome associated with a novel nonsense mutation in the penultimate exon of SOX10.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets