Dataset Information

Association of VEGF genetic polymorphisms with recurrent spontaneous abortion risk: a systematic review and meta-analysis.

ABSTRACT:

Background

Studies of the associations between the genetic polymorphisms of the vascular endothelial growth factor (VEGF) gene and recurrent spontaneous abortion (RSA) have revealed conflicting results. The present meta-analysis was performed to provide a more precise estimation of these relationships and to explore potential sources of heterogeneity that may have influenced the reported disparities.

Methods

An extensive literature search for relevant studies was conducted on PubMed, Embase, and The Cochrane Library through June 6, 2014. Crude odds ratio (OR) with 95% confidence intervals were calculated.

Results

10 case-control studies including 1,832 RSA patients and 2,271 healthy controls were identified. Meta-analysis indicated that rs1570360, rs3025039, rs2010963, and rs3025020 polymorphisms in the VEGF gene correlated with elevated RSA risk. The rs1570360 variant was statistically significantly relevant to RSA risk among non-Asian populations. Interestingly, the rs3025039 variant was statistically significantly relevant to RSA risk among Asian populations.

Conclusions

The current meta-analysis indicates that rs1570360, rs3025039, rs2010963, and rs3025020 polymorphisms increase RSA susceptibility. Moreover, rs1570360 and rs3025039 polymorphisms may play various roles in RSA susceptibility in various geographic groups.

SUBMITTER: Xu X

PROVIDER: S-EPMC4404341 | biostudies-literature | 2015

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Association of VEGF genetic polymorphisms with recurrent spontaneous abortion risk: a systematic review and meta-analysis.

Xu Xinghua X Du Chigang C Li Huihui H Du Jing J Yan Xue X Peng Lina L Li Guangyao G Chen Zi-Jiang ZJ

PloS one 20150420 4

<h4>Background</h4>Studies of the associations between the genetic polymorphisms of the vascular endothelial growth factor (VEGF) gene and recurrent spontaneous abortion (RSA) have revealed conflicting results. The present meta-analysis was performed to provide a more precise estimation of these relationships and to explore potential sources of heterogeneity that may have influenced the reported disparities.<h4>Methods</h4>An extensive literature search for relevant studies was conducted on PubM ...[more]

PMID: 25894555

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Association of VEGF genetic polymorphisms with recurrent spontaneous abortion risk: a systematic review and meta-analysis.

Background

Methods

Results

Conclusions

Publications

Association of VEGF genetic polymorphisms with recurrent spontaneous abortion risk: a systematic review and meta-analysis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets